120612
This week in lab, I got my DNA sequencing results back. It was found that the forward sequence was about the right gene size (about 1170 bp) as Wbm DXR, but the bad news was that there were many 'N' misreads in the forward read of the sequence. Perhaps I should have used more of the PCR cleanup DNA when sending to sequencing, but according to the PCR cleanup nanodrop results, I didn't need a large volume of DNA to equal 500 ng that was needed to send to DNA sequencing. The reverse read of the DNA sequencing results came back with only about 550 base pairs, which is a lot less than the Wbm DXR gene, and there were also a lot of misreads in the DNA sequence. After a nucleotide BLAST, it was found that the forward read matched up best to the chromosome of a foreign bacteria that I have never heard of. In fact, no Wolbachia gene or DXR gene was in the top results of the BLAST. This meant that the secondary product that I further amplified was not the correct Wbm DXR gene. So I decided to try one last PCR attempt this week before the semester ended. In this attempt, I changed only the annealing temperatures to 59, 60, and 61 degrees Celsius, which I never have used before. The same primary PCR template that worked a few weeks ago was still used as the template to build the secondary PCR product off of. Once again, none of the different conditions mattered because no correct gene was synthesized. Perhaps the primary PCR template was getting old since it is a few weeks old, but since the semester has ended, I'll never know if that was the case. Along with these things, I also participated in cleaning up the lab and writing my final research report this week.
120412
Figure 1: Secondary PCR trials under many different conditions. The secondary PCR mixture was created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary/secondary PCR mixture, 1 uL of 20 mM custom forward tail primer, 1 uL of 20 mM custom reverse tail primer, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. The changes done to this PCR attempt were the temperatures used to anneal the primers at. Also, since the third lane was performed at the VDS protocol recommended 58 degrees Celsius annealing temperature, it was decided that only this PCR reaction was to be done at the extended [1] DNA Works PCR conditions. As the gel shows, none of the secondary PCR reactions formed a distinct band, and the 58 degree Celsius extended PCR reaction seemed to almost form a primary smear, which is not what was expected.
Lane 1: Skip
Lane 2: 100 bp ladder
Lane 3: Secondary PCR Wbm DXR gene created off of primary PCR template and under extended [1] thermocycler conditions listed in the VDS protocol, with a 58 degree Celsius annealing temperature used
Lane 4: Secondary PCR Wbm DXR gene created off of primary PCR template and under normal thermocycler conditions listed in the VDS protocol, except a 59 degree Celsius annealing temperature was used
Lane 5: Secondary PCR Wbm DXR gene created off of primary PCR template and under normal thermocycler conditions listed in the VDS protocol, except a 60 degree Celsius annealing temperature was used
Lane 6: Secondary PCR Wbm DXR gene created off of primary PCR template and under normal thermocycler conditions listed in the VDS protocol, except a 61 degree Celsius annealing temperature was used
[1] Hoover, D. M.; Lubkowski, J., DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. Nucleic Acids Res2002,30 (10), e43.
Figure 1: Nucleotide NCBI BLAST of sequencing results of the forward read of the PCR cleanup that was done on the Wbm DXR gene previously. The BLAST was done against the all nucleotide collection database, and the most similar sequences were not sequences from organisms that were Wolbachia. As a matter of fact, not even a DXR gene from another organism appeared as a similar sequence. This could be due to the fact that there were a lot of ‘N’ nucleotides that could not be read by the DNA sequencer. The reverse read didn’t read more than about 550 nucleotides, and there were a lot of ‘N’ nucleotides within.
Figure 2: Pairwise nucleotide comparison of the most similarly found sequence to the forward read sequencing result of the Wbm DXR CDS. The organism was Agrobacterium sp., and the similar sequence came from one of its circular chromosomes. There was a 66% query coverage, for the Agrobacterium gene was a lot smaller than the 1170 bp Wbm DXR gene. There was also a 66% max identity for this sequence. The low quality read of the sequencing results may be to blame for the wonky results. It should be noted that trying to align the codon optimized sequence of Wbm DXR to these sequencing results yields ‘no significant similarity found’.
Figure 3: Forward read by the DNA sequencer for the Wbm DXR gene which was synthesized and PCR cleaned up earlier last week (the abnormal 118 ng/uL concentration). Notice that there were a lot of misreads (N) in the gene sequence readout, and this may have lead to bad nucleotide BLAST results.
Figure 4: Reverse read by the DNA sequencer for the Wbm DXR gene which was synthesized and PCR cleaned up earlier last week (the abnormal 118 ng/uL concentration). Notice that there were a lot of misreads (N) in the gene sequence readout, and this may have lead to bad nucleotide BLAST results. Also, there was only about 550/1170 nucleotides that should have been read.
120212
The University of Texas at Austin
College of Natural Sciences - Office of the Dean
1 University Station G2550
Austin, TX 78712
This week in lab I tried many different PCR techniques in order to attempt to produce a viable secondary PCR product. First, I attempted secondary PCR off of a previously determined successful primary PCR with custom tail primers at 58 and 62 degrees Celsius annealing temperatures, and I also tried to use the first/last and 3rd/28th oligonucleotides as primers instead of tail primers at the same annealing temperatures. The theory was that the oligonucleotides should've binded to the fully synthesized correct gene fragment that resided in the primary PCR product and thus amplify the correct gene with oligo primers instead of custom tail primers whose ends were made to fit the gene into a pNIC-Bsa4 vector. A pUC-19 cloning vector could then be used to clone into, and then the pNIC-Bsa4 expression vector could then be used, but the oligo primers didn't seem to work out in creating a secondary PCR product. This could have been because the annealing temperatures for the single oligonucleotide primers wasn't optimal, or there may have been something totally wrong with the way the primary PCR was synthesized originally. Either way, I still continued to perform a secondary PCR reaction off of the one secondary PCR product that worked from what I explained above (tail primers at 58 degree Celsius annealing temperature). Although the secondary band was feint and seemed to appear a little bigger on the gel than the actual WbmDXR gene size (about 1200 bp), I decided to perform many other secondary (not really PCR squared, but the secondary reaction of the secondary product) reactions at different conditions in order to try to further amplify the gene. I tried to perform normal protocol secondary PCR at 57 degrees Celsius annealing temperatures and this seemed to produce somewhat successful secondary product. Secondary PCR done at 58 degrees Celsius annealing temperatures didn't seem to work this time even though that was the temperature used to create the band in which was now the template for the secondary of the secondary PCR reaction in the previous PCR mentioned above. The 62 degree Celsius annealing temperature worked for the normal thermocycler conditions listed in the VDS protocol, but not for the suggested DNA works journal article's extended thermocycler condition protocol. This suggestion was used in for a 58 and 62 degree Celsius annealing temperature PCR reaction, but neither seemed more successful than the normal VDS protocol PCR thermocycler conditions. Lanes 3, 4, 5, and 9 from the gel in Figure 2 were combined, PCR cleaned up, and sent to DNA sequencing. The nanodrop concentrations of the initial 138 uL total of lanes 3, 4, 5, and 9 that were eluted in 50 uL of Tris HCl are shown below and are abnormally high (especially since a true PCR squared reaction wasn't done). Next week I will await the results of the DNA sequencing to see if the proper gene was synthesized, and I will either look at a Gene Block method of ordering the correct gene (cheating), or I will try to order new oligonucleotides for the project with the tail primer sequences already incorporated into the first and last oligonucleotides. I may also consider trying to do another enzyme assay with what Fab I protein I have left in order to get some better raw data concentrations for my final report.
112812
Figure 1: First of two measurements for the concentration of PCR cleanup on four of the secondary PCR reactions that were done on the latest agarose gel. The remaining 38 uL (after running an initial gel check) of each of the secondary reactions used were Lanes 3, 4, 5, and 9 from the previous gel. The PCR product corresponding to each of these lanes was combined and underwent PCR cleanup. Notice that the concentration for this measurement is fairly high for a PCR cleanup, so until DNA sequencing results come back, this data should be taken with a grain of salt.
Figure 2: Second of two measurements for the concentration of PCR cleanup on four of the secondary PCR reactions that were done on the latest agarose gel. The remaining 38 uL (after running an initial gel check) of each of the secondary reactions used were Lanes 3, 4, 5, and 9 from the previous gel. The PCR product corresponding to each of these lanes was combined and underwent PCR cleanup. Notice that the concentration for this measurement is fairly high for a PCR cleanup, so until DNA sequencing results come back, this data should be taken with a grain of salt.
112712
Figure 2: Secondary PCR trials under many different conditions. The secondary PCR mixture was created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary/secondary PCR mixture, 1 uL of 20 mM custom forward tail primer, 1 uL of 20 mM custom reverse tail primer, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. The changes done to this PCR attempt were the temperatures used to anneal the primers at, the template used to build the secondary product off of, and the overall thermocycler temperature conditions and times.
Lane 1: Skip
Lane 2: 100 bp DNA ladder
Lane 3: Secondary PCR Wbm DXR gene created off of primary PCR template and under normal thermocycler conditions listed in the VDS protocol, except a 57 degree Celsius annealing temperature was used
Lane 4: Secondary PCR Wbm DXR gene created off of secondary PCR template which was mildly successful from 11.26.12 creation date and under normal thermocycler conditions listed in the VDS protocol, except a 57 degree Celsius annealing temperature was used
Lane 5: Same as Lane 4
Lane 6: Secondary PCR Wbm DXR gene created off of primary PCR template and under normal thermocycler conditions listed in the VDS protocol (58 degree Celsius annealing temperature used)
Lane 7: Secondary PCR Wbm DXR gene created off of secondary PCR template which was mildly successful from 11.26.12 creation date and under normal thermocycler conditions listed in the VDS protocol, except a 58 degree Celsius annealing temperature was used
Lane 8: Secondary PCR Wbm DXR gene created off of secondary PCR template which was mildly successful from 11.26.12 creation date and under suggested thermocycler conditions listed in the referenced article1, except with a 58 degree Celsius annealing temperature instead of the suggested 62 degree Celsius annealing temperature
Lane 9: Secondary PCR Wbm DXR gene created off of secondary PCR template which was mildly successful from 11.26.12 creation date and under normal thermocycler conditions listed in the VDS protocol, except a 62 degree Celsius annealing temperature was used
Lane 10: Secondary PCR Wbm DXR gene created off of secondary PCR template which was mildly successful from 11.26.12 creation date and under suggested thermocycler conditions listed in the referenced article1, and the suggested 62 degree Celsius annealing temperature was used
[1] Hoover, D. M.; Lubkowski, J., DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. Nucleic Acids Res2002,30 (10), e43.
112612
Figure 1: Secondary PCR results from primary PCR mixture that was successfully created a few weeks ago at a 58 degree Celsius annealing temperature. The secondary PCR mixture was created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary PCR mixture, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. The changes done to this PCR attempt were the primers used and the temperatures used to anneal them at. Notice that there was a feint band in Lane 3 representing the relative position in which the synthesized DXR gene would reside, but the band is not vibrant enough and isolated enough from any other contamination to be a solid candidate to run PCR squared on.
Lane 1: Skip
Lane2: 100 bp DNA ladder
Lane 3: Secondary PCR Wbm DXR gene with custom forward and reverse tail primers at 58 degree Celsius annealing temperature
Lane 4: Secondary PCR Wbm DXR gene with custom forward and reverse tail primers at 62 degree Celsius annealing temperature
Lane 5: Secondary PCR Wbm DXR gene with IDT ordered oligonucleotide #1 as the forward primer and oligonucleotide #30 as the reverse primer at 58 degree Celsius annealing temperature
Lane 6: Secondary PCR Wbm DXR gene with IDT ordered oligonucleotide #1 as the forward primer and oligonucleotide #30 as the reverse primer at 62 degree Celsius annealing temperature
Lane 7: Secondary PCR Wbm DXR gene with IDT ordered oligonucleotide #3 as the forward primer and oligonucleotide #28 as the reverse primer at 58 degree Celsius annealing temperature
Lane 8: Secondary PCR Wbm DXR gene with IDT ordered oligonucleotide #3 as the forward primer and oligonucleotide #28 as the reverse primer at 62 degree Celsius annealing temperature
112612
112612 - Good. Dr B
Freebee from last week's journal club!!!
111812
Daniel - well done! -- Dr. B 11/19/12
This week I continued with secondary PCR attempts on Urvashi's DXR target. I used the both the 57 and 58 degree Celsius annealing temperature primary PCR product that was successfully synthesized last week (shown in Figure 2 of last week) in order to try to successfully make secondary product with newly diluted forward and reverse tail primers. The end result is shown in Figure 1 below. There was basically no distinct secondary PCR band that represented the correct DXR gene size on the gel when taking the 57 degree Celsius primary PCR product and performing secondary at 58 and 62 degree Celsius annealing temperatures this time. There were also no distinct secondary bands when taking the 58 degree Celsius primary PCR product and performing secondary at 58 and 62 degree Celsius annealing temperatures with this other batch of successful primary PCR product. The thought was that one primary product may have been a better template to build the secondary off of than the other due to the one degree difference in annealing temperatures when synthesizing the primary. Apparently this made no difference because there was no overall success at creating a successful secondary PCR product. Next week, I will try to perform a secondary PCR with the first and last oligonucleotides instead of the tail primers. This will judge whether the tail primers are the reason for the lack of amplification of the primary PCR product. If this is the case, I will have to consider cloning into a PUC-19 cloning vector instead of straight into the pNIC-BSA4 expression vector. I also analyzed my results of the CB diversity set of ligands for the virtual screening of my Wbm Fab I homology model this week. It took about two weeks to run the job on 6 processors, and it didn't even completely finish before I had to kill it. But for the most part, about 35 k out of the 50 k ligands were screened, which is a good enough amount to analyze anyways. The results are shown in Table 1 below for the top 30 ligands that GOLD predicted to bind the best in the active site of my homology model. Lipinski's Rule and PyMol analysis was done and shown in Table 2. It seems as if the second top ranked compound may be a good possible drug candidate. The top ranked ligand is shown in Figure 2.
Figure 1: Secondary PCR results from my primary PCR mixture. The secondary PCR mixture was created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary PCR mixture, 1 uL of both 20 mM forward and reverse custom Wbm DXR primers that were newly diluted, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. 29 cycles of normal thermocycler conditions were used, including 58 (Lane 3/4) and 62 (Lane 5/6) degree Celsius annealing temperatures. As can be seen, the 100 bp DNA ladder showed up in Lane 2, but no viable secondary PCR band appeared in Lanes 3, 4, 5, or 6 when added and ran in 1x TAE buffer via gel electrophoresis for 45 minutes at 110 Volts.
Score
S(PLP)
S(hbond)
S(cho)
S(metal)
DE(clash)
DE(tors)
intcor
time
Ligand name
98.5
-96.86
1
0
0
0
0.79
0.17
5.332
6433994'
96.99
-93.62
1.77
0
0
0
1.1
0.26
5.561
7566969'
96.87
-97.61
1
0
0
0
2.19
0.54
7.157
7645746'
96.13
-94.4
1
0
0
0.09
1.8
2.35
6.853
6271180'
95.8
-96.84
0
0
0
0
1.5
1.96
6.198
9019562'
95.78
-90.54
2
0
0
0
2.26
3.71
1.825
7536889'
95.31
-95.72
0
0
0
0
1.31
2.21
7.768
7545276'
94.99
-93.35
1
0
0
0
2.71
4.05
5.272
'9025491'
94.98
-94.26
1
0
0
0
2.88
3.28
7.585
7616245'
94.8
-92.29
1
0
0
0
1.95
3.4
7.893
7626463'
94.59
-93.6
1
0
0
0
2.07
1.95
2.673
6396905'
94.41
-92.43
1.6
0
0
0
4.37
5.92
6.778
7608040'
94.33
-89.9
2
0
0
0.29
1.29
1.31
7.344
'7610938'
94.31
-99.43
0
0
0
0
3.02
0.92
7.038
'5187026'
93.64
-92.61
1.99
0
0
0
2.89
0.74
7.286
'6286155'
93.64
-92.85
1
0
0
0
2.09
1.98
1.803
'6408506'
93.62
-94.57
0
0
0
0.01
3.28
5.62
7.439
'5128658'
93.61
-92
1
0
0
0
1.16
0.92
7.833
'7506319'
93.57
-92.28
0.82
0
0
0
1.31
1.46
5.87
'7534661'
93.35
-93.2
0.13
0
0
0
1.03
1.09
9.649
'6448319'
93.05
-87.83
1.99
0
0
0
0.43
0.11
1.854
'9039281'
92.71
-91.28
1
0
0
0
1.92
2.26
7.042
'5235187'
92.67
-91.19
1
0
0
0.91
0.32
0.04
5.252
'7272762'
92.44
-90.2
0.98
0
0
0
1.02
1.35
5.047
'5881706'
92.33
-88.37
1.67
0
0
0
1.09
1.11
9.857
'7571019'
91.86
-86.82
2.9
0
0
0
2.17
0.66
7.176
'5192207'
91.61
-89
1.99
0
0
0
1.83
0.29
5.861
'9034285'
91.56
-93.34
0
0
0
0.76
1.84
2.35
6.322
'7512496'
91.48
-88.6
1.41
0
0
0
0.88
0.21
6.826
'7112563'
91.4
-94.4
0
0
0
0
1.83
0.67 1
1.368
'5856118'
Table 1: Top 30 ligands predicted by GOLD program when screening Chembridge diversity set of ligands against the active site of the Wbm Fab I homology model enzyme. The higher the fitness score, the better chance of the compound being able to bind to the active site, and this inhibit the Wbm Fab I protein. Other columns of the table represent some of GOLD’s criteria in its prediction of the protein-ligand binding affinities. The last column represents the ID number of the compound that can be ordered on the ChemBridge website.
Score
Ligand name
Molecular Weight
H-Bond Donor
H-Bond Acceptor
LogP
Polar Contacts
98.5
6433994'
445
0
3
3.66
3
96.99
7566969'
458
0
5
1.96
3
96.87
7645746'
434
0
7
3.67
1
96.13
6271180'
437
0
4
4.14
2
95.78
7536889'
462
0
4
3.87
0
95.31
7545276'
468
0
3
3.84
1
94.98
7616245'
498
0
3
4.28
1
94.8
7626463'
465
1
5
3.86
1
94.59
6396905'
403
0
1
3.98
3
94.41
7608040'
484
0
3
4.29
1
Table 2: Top 10 ligands from GOLD’s predicted binding affinities to the active site of theWbmFab I homology model enzyme out of the 49,797 ligands screened from the Chembridge diversity set of ligands. Higher number of polar contacts (determined from PyMol) signifies good potential protein-ligand interactions. Lipinski’s Rule of 5 includes a molecular weight no greater than 500 daltons, no more than 5 H-bond donors and 10 H-bond acceptors, and a LogP no greater than 5.00.
Figure 1: Top ranked ligand by initial Run 1 GOLD virtual screening program in the active site of the homology model protein of the Wbm Fab I protein when viewed in PyMol. The homology model was made by Swiss-Model off of the template Fab I protein 3K31 (Anaplasma phagocytophilum). The active site was of this homology model protein was defined by superimposing the Thermus thermophilus (2WYW) Fab I protein onto the homology model and figuring out where its triclosan (TCL) compound was positioned (next to NADH substrate already in homology model active site). After removing the NADH and TCL ligands, the active site was defined within 7.5 Angstroms of the TCL ligand. This is compound 6433994 from the Chembridge diversity set library. The homology model protein residues are shown in a green carbon color scheme as surface. The compound 6433994 ligand is shown as sticks in a cyan carbon color scheme. Polar contacts between the ligand and the active site residues are shown as black dashed lines.
110812
This week I began work on Urvashi's Wbm DXR target. She was focusing on primary and secondary PCR's. So i decided to first try to use the Primary PCR mix that she said worked in successfully creating a nice secondary band about two weeks ago (but that secondary band didn't produce a good PCR squared for her). The results are shown below in Figure 1 with a standard 58 degree Celsius annealing temperature. The ladder showed up, but the secondary PCR product did not. So in hopes of starting fresh, I used a brand new oligo mix that Janice just made and ran primary PCR reaction at both 57 and 58 degrees of annealing temperatures. The primary results for both annealing temperatures seemed favorable based off the gel in Figure 2, but when a secondary PCR reaction was ran with the primary products that were produced, unfavorable results were found. With the 57 degree Celsius secondary PCR reaction that was run with the 57 degree Celsius primary product, two bands (one large and one small) showed up faintly, and these bands did not represent the DXR gene whatsoever. With the 58 degree Celsius secondary PCR reaction that was run with the 58 degree Celsius primary product, no visible bands even showed up. This leads me to believe that perhaps the annealing temperatures for the secondary PCR reactions need to be changed, or the primary and secondary reactions need to be ran again with hopes of less contamination appearing in the gel. Next week I will try to run another secondary PCR reaction from the favorable primary PCR products in Figure 2 at different annealing temperatures. If this doesn't work, I may have to start from scratch and make another primary PCR template that may be less contaminated in order to successfully run a secondary reaction.
Figure 1: Secondary PCR results from Urvashi’s primary PCR mixture which she said worked previously at 58 degrees Celsius annealing temperature. The primary PCR mixture was created on 10.19.12. The secondary PCR mixture was created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary PCR mixture, 1 uL of both 20 mM forward and reverse custom Wbm DXR primers, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. 20 cycles of normal thermocycler conditions were used, including a 58 degree Celsius annealing temperature. As can be seen, the 100 bp DNA ladder showed up in Lane 2, but no secondary PCR band appeared in Lanes 3 and 4 when added and ran in 1x TAE buffer via gel electrophoresis for 45 minutes at 110 Volts.
Figure 2: Primary PCR created from overlapping oligonucleotides of Urvashi’s DXR custom ordered (from IDT) are shown in Lanes 2 and 3. 30 cycles of normal thermocycler conditions were used, except a 57 degree Celsius annealing temperature was used on Lane 2’s primary PCR while a 58 degree Celsius annealing temperature was used on Lane 3’s primary PCR. Primary PCR mixture was created with created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of custom Wbm DXR oligonucleotide mixture, 1 uL of KOD hotstart Polymerase, and 35 uL of sterile water. Lane 4 represents secondary PCR made from the primary PCR mixture in Lane 2 with an annealing temperature of 57 degrees Celsius and all other portions of the 30 cycles of the thermocycler conditions normal. Lane 5 represents secondary PCR made from the primary PCR mixture in Lane 3 with an annealing temperature of 58 degrees Celsius and all other portions of the 30 cycles of the thermocycler conditions normal. The secondary mixtures were created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary PCR mixture (from either Lane 2 or 3), 1 uL of both 20 mM forward and reverse custom Wbm DXR primers, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. As can be seen, the 100 bp DNA ladder showed up in Lane 2, and both primary PCR’s showed a nice distinct smear that was expected. Lane 4 showed a feint band near the 500 bp range while Lane 5 showed no secondary PCR results. The band at Lane 4 must represent contamination because Urvashi’s DXR target is easily over 1000 bp in length.
110112
This week I focused on making myself a homology model and attempting to do virtual screening with that model. It was found that the template protein for my homology model was the Anaplasma phagocytophilum Fab I enoyl-acyl carrier protein (From Swiss-Model) (3K31). My WbmFab I homology model was built off this enzyme by Swiss-Model, and the program kept the NAD substrate from the Anaplasma phagocytophilum in the homology model protein, which was helpful to define the active site of my homology model. But when I was configuring my gold.conf file, Hermes didn't want to show the NAD substrate as anything other than disconnected atoms. So I spent a long time trying to sort out how I could extract the ligand and define the active site. I settled on deleting the atoms of the NAD ligand in PyMol and then superimposing the Triclosan (TCL) ligand that was in the active site of a similar Fab I protein from T. thermophilus onto my homology model and saving the TCL ligand within my homology model protein while deleting the rest of the T. thermophilus Fab I protein residues. This ligand was superimposed right next to where NAD once was (before deletion), so this is how I knew TCL was in the active site. Once this problem was solved, I proceeded to define the active site around TCL and then extracted the ligand as a .mol2 file. I first ran an initial GOLD run with the CB 306 library in order to see if the GOLD screening process worked. It ran for about 7 hours on 1 processor, and the top 10% of those ligands are shown in the table on Figure 3. I then ran a quick 1 ligand run with the extracted TCL ligand back in the active site of the homology model, which is shown in Figure 2. The GOLD score (shown in Figure 3) was not impressive, and it ranked very low compared to the top 10% ligands from the CB 306 library. This low score could be because the TCL ligand didn't line up exactly correct when superimposing it to define the active site of my homology model. It should be considered that the alignment will not be perfect and that the superimposing/aligning was only to define an active site of my homology model. It also isn't known if TCL is an inhibitor of the Wbm Fab I protein just because it is for another Fab I protein of another organism. On Thursday I began running the large CB diversity library of nearly 50,000 ligands on 6 processors, and I look forward to seeing if there were any extraordinarly great compounds that GOLD screened, because the CB 306 library didn't produce any super great compounds. Next week I will analyze the GOLD diversity set run and also start helping Urvashi on any of her cloning steps.
Figure 1:PyMol image of the best docked conformation (out of 10) of ligand 145 of the 306 ligands from the CB306 library that was screened in GOLD at an austoscale of 0.1 against the homology model created for my Wbm Fab I protein. This ligand received a fitness score of 79.53, which is fairly high for a GOLD score. A second run of the top 10% (31 best ligands from Run 1) will validate whether this ligand may be a good inhibitor or not.
Figure 2: PyMol image of triclosan (TCL) which is a known inhibitor for other Fab I proteins of different species. This ligand was used to define the active site of the homology model (although it came from superimposing the ligand onto the homology model from the T.thermophilus Fab I protein. This ligand received a low fitness score from a GOLD run of 56.89. This score may be expected to be much higher, but with a homology model, it is not certain that TCL is a good inhibitor of the Wbm version of the protein. Furthermore, the homology model isn't directly the exact Wbm Fab I protein, it's just a predicted model.
Figure 3: Top 31 ligands (top 10% of library) from the small library of 306 ligands from the CB306 sdf file after inital screening by GOLD at an autoscale of 0.1 for the homology model of my Wbm Fab I protein that was based on the template of Fab I for A. phagocytophilum. Top ranked compound came in with a score of 79.53, while it should be noted that the inhibitor triclosan (TCL) came in with a low score of 56.89 when docked by GOLD back into the active site of the homology model protein. It should also be noted that the TCL inhibitor should not technically be expected to receive a high score because it was a known inhibitor of a Fab I protein from T. thermophilus. The TCL from another homologous protein was only used to be superimposed onto the homology model protein in order to try to roughly define the active site of the homology model.
102812
This week was a week of extreme disappointment. I spent the first half of the week midiprepping the DH5a pellets that I grew up last week, which were previously transformed with the new GST plasmid vector. The concentrations turned out quite high for the pEG(kt) vector, but it turned out that this happened to be a yeast expression plasmid that I couldnt use for transformation into bacteria. For the second half of the week, I spend a good amount of time trying to purify my two seperate 2.0 g protein pellets that were both grown up in 500 mL of LB last week for 18 hours at room temperature. My hopes were that the bacterial ribosomes would translate my protein slower so that multimers could be avoided. After sonicating one pellet with a normal sonication buffer, and lysing the other pellet with the once determined "hopeful" pH 5.05 B-Per solution, I proceeded to purify after making sure the lysed solutions were at around a pH between 7.5-8.0. For the B-Per solution I used a column with old Ni-NTA resin in it, and for the sonicated solution, I used a fresh column with fresh Ni-NTA resin. After purifying and characterizing (gel will be shown on the next week's wikispaces), there was some hope that my Fab I protein made it through to the Elution 1 step because it seemed that for each the sonicated and B-per'd solutions, there was a nice distinct but faint band in the exact location of where my protein would be expected. But the issue was that the Elution 1 bands were showing up very weak/faint even though I allowed a nice two hours for it to stain, and even after I gave it overnight to de-stain. My hopes were that the bands were faint cause of the Imperial protein stain being too old, but this was found out to not be the case after nanodropping the Elution 1's from the B-Per and the sonicated solutions (See Figures 5 and 6). With a nanodrop concentration near zero at 280 nm, it was time to think about the GST vector. But sadly, the vector that I was working on as a side project to clone into was a yeast vector (as explained previously). So now my project is at a standstill, and I may have to work with Urvashi on her Wbm DXR project. So beginning next week I will ask her if she needs any help on her project, and I may still be looking into a bacterial GST vector with Dr. B.
Figure 1: Run 1 of first of two midiprepped pEG(kt) plasmid nanodroped (wavelength measured at 260 nm). Notice that the concentration is quite high for this vector compared to a concentration that was taken from a pNIC-BSA4 plasmid earlier in the summer.
Figure 2: Run 2 of first of two midiprepped pEG(kt) plasmid nanodroped (wavelength measured at 260 nm). Notice that the concentration is quite high for this vector compared to a concentration that was taken from a pNIC-BSA4 plasmid earlier in the summer.
Figure 3: Run 1 of second of two midiprepped pEG(kt) plasmid nanodroped (wavelength measured at 260 nm). Notice that the concentration is quite high for this vector compared to a concentration that was taken from a pNIC-BSA4 plasmid earlier in the summer.
Figure 4: Run 2 of second of two midiprepped pEG(kt) plasmid nanodroped (wavelength measured at 260 nm). Notice that the concentration is quite high for this vector compared to a concentration that was taken from a pNIC-BSA4 plasmid earlier in the summer.
Figure 5: Elution 1 of purified Wbm Fab I protein after expressing for 18 hours at 25 degrees Celsius. The BL21 cells that this protein was grown up in was lysed with a normal sonication buffer via sonication. Notice that the concentration of protein is extremely low, and FPLC is probably not worth the time.
Figure 6: Elution 1 of purified Wbm Fab I protein after expressing for 18 hours at 25 degrees Celsius. The BL21 cells that this protein was grown up in was lysed with a the B-Per buffer that was at pH of 5.05 that was made a couple of weeks ago. Notice that the protein concentration showed up as a negative value, thus signifying that pretty much there was not enough protein for even the expensive nanodrop spectrophotometer to even pick up on.
102112- Daniel, good deal. I am eager to see if the overnight expression worked! - Dr. B
101912
This week I went in two separate directions for my research project. My first direction was to express more of my Wbm Fab I protein on a large scale. By using two 2L flasks of 500 mL of LB each, I successfully grew up the two cell+protein pellets that are shown in Figure 2. The starter cultures that I made for the expression took an abnormal amount of time to grow and some didn't grow at all. I ended up using one of my starter cultures that I grew up overnight at room temperature in one of the shaking incubators in the Biotech Lab. The fact that some of these cultures didn't grow up properly means that I should probably transform some more of my cloned gene into BL21's for future expressions to go more smoothly. The starter culture that did grow up properly was then placed in the two giant flasks of LB until an OD600 of 0.1 was reached. I then grew up these large flasks at 37 degrees Celsius until an OD600 of 0.65 was reached (I want to see what a slight overexpression may do to my protein product). Then I turned the shaking incubator down to 25 degrees Celsius (room temperature), and then I induced the bacteria with IPTG. I proceeded to allow the bacteria to translate my protein for exactly 18 hours overnight, and then I spun down the cells that are shown in Figure 2. The only problem was that the growth was actually at 29 degrees Celsius according to the thermometer on the Biotech Lab shaking incubator, and the temperature wouldn't go any lower. The second direction in which I went in this week was to transform the pEG(KT) vector that was taken from the Robertus Lab last week into DH5a's. It was found that this plasmid carries the AMP resistance gene and not the Kan resistance gene. Some colonies on the AMP plate were then grown up overnight in a 37 degree shaking incubator and then spun down to retain the cell pellet that is shown in Figure 1. The next step is to midiprep this to extract large volumes of the plasmid DNA. Then based on purification next week, I will decide if I want to go ahead with trying to clone with this GST tag vector or continue with purification and expression of my His-tagged protein as is.
Figure 1: Image of DH5a cell+pEG(KT) replicated plasmid grown up in Ampicillin overnight at 37 degrees Celsius and spun down at 6000 x g on Allegra benchtop centrifuge for 15 minutes at 4 degrees Celsius. These pellets were placed in the -20 degree Celsius freezer for later midiprepping of the DNA.
Figure 2: Image of BL21 cell pellet + expressed Wbm Fab I protein after large scale expression that slightly overexpressed these cells to grow to an OD600 of about 0.65 at 37 degrees Celsius before inducing with IPTG and allowing to express protein overnight at room temperature on shaking incubator. The bacteria and protein were spun down with the JA-10 rotor in the large Beckman-Coulter centrifuge at 6000 x g for 20 minutes at 4 degrees Celsius. The resulting pellet was frozen in the -80 degree Celsius freezer for later purification and characterization steps.
101112
This week I lysed the BL21 cells that expressed my protein. I had three cell pellets that were expressed in 150 mL of LB last week. One of the pellets was lysed through normal sonication with a normal sonication buffer (4 mL) that had a higher ionic concentration (500mM NaCl). The second pellet was lysed with 4 mL of B-Per solution with a pH adjusted to 5.05. The third pellet was lysed with 4 mL of B-Per solution with a pH adjusted to 8.65. After purifying the clarified lysate soluble fractions of my three pellets through a Ni-NTA column, it was found that my protein was somewhat included in the soluble fraction of all three lysing conditions. The pH 5.05 B-Per buffer seemed to produce the best and most distinct band for the first elution. The pH 8.65 buffer didn't produce quite as distinct a elution 1 band. Although these bands showed up, they weren't very distinct at all. There were contaminate bands that showed up in the elutions that appeared more distinctly than my actual protein (these bands did not represent multimers of my protein). Now there are a few options of where to go from here on out. On one hand, there is some of my protein being expressed and making it through the Ni-NTA column in small amounts, but these amounts aren't huge. But the good news is that my protein has been found to be active in my enzyme assay that I performed a week ago. On the other hand, it takes so much time and effort to make such small amount of my protein although it is active. Now I have to make a decision if I want to continue to try to express under different conditions until the optimal condition is found, or I could go on and perform a large scale expression with this pH 5.05 B-Per buffer. The other option is to use another vector (pEG(KT)) that expresses a GST tag instead of a His tag. I should decide on what direction I want to turn to for next week's lab work.
Figure 1: Image of my SDS-page gel after testing separate lysing conditions for my WBM FABI protein. (Lane 1 on far right - Lane 8 on far left). My FABI protein was present in the soluble fraction and the first elution, but it was very faint, which indicates that a lot of the protein did not make it thru the Ni-NTA column. There also was a fairly distinct band that I circled that made it thru the Ni-NTA column. This band does not represent a dimer of my protein, and I do not know what this protein is.
Lane 1: Prestained pageruler protein ladder
Lane 2: Soluble fraction after sonicating with 500 mM NaCl, 100 mM Tris, 10 mM Imidazole buffer
Lane 3: Soluble fraction after lysing with B-Per solution that was pH balanced to a pH of 5.05
Lane 4: Elution 1 of the FABI protein that was lysed at pH 5.05 by B-Per
Lane 5: Elution 2 of Lane 4
Lane 6: Soluble fraction after lysing with B-Per solution that was pH balanced to a pH of 8.65
Lane 7: Elution 1 of the FABI protein that was lysed at pH 8.65 by B-Per
Lane 8: Elution 2 of Lane 7
Figure 2: Plasmid map of pEG(KT) vector. This vector might be used to clone my WBM FABI gene into because this vector expresses a GST tag instead of a His Tag. The His tag from the pNIC-BSA4 cloning that I have right now may be aggregating towards the center of my protein, thus not being able to stick to the Ni-NTA resin in the column.
101012
Figure 1: Nanodrop of WBM FABI protein at 280 nm from Elution 1 of purified (Ni+NTA column) protein. This was the first of the two Nanodrop concentrations from the same Elution 1 sample conical tube. This was the protein that was lysed from E. Coli BL21 competent cells with a B-Per buffer with a pH of 5.05
Figure 2: Nanodrop of WBM FABI protein at 280 nm from Elution 1 of purified (Ni+NTA column) protein. This was the second of the two Nanodrop concentrations from the same Elution 1 sample conical tube. This was the protein that was lysed from E. Coli BL21 competent cells with a B-Per buffer with a pH of 5.05
Figure 3: Nanodrop of WBM FABI protein at 280 nm from Elution 1 of purified (Ni+NTA column) protein. This was the first of the two Nanodrop concentrations from the same Elution 1 sample conical tube. This was the protein that was lysed from E. Coli BL21 competent cells with a B-Per buffer with a pH of 8.65
Figure 4: Nanodrop of WBM FABI protein at 280 nm from Elution 1 of purified (Ni+NTA column) protein. This was the second of the two Nanodrop concentrations from the same Elution 1 sample conical tube. This was the protein that was lysed from E. Coli BL21 competent cells with a B-Per buffer with a pH of 8.65
100912 - Daniel, ok good. hopefully the BPER with basic conditions works in a scale up expression along with new purification buffers and new ni-nta resin. - DR. B
We'll also pursue the GST tag
100512
This week I primarily focused on a pair of related things. First, I spent time making 2 10ml aliquots of B-Per lysis solution with different conditions associated with them both. The first B-Per solution involved setting the pH of the solution to 5, and the second solution involved setting the pH to 8.5. Hopefully these pH conditions will help solve the protein problem that I am having when trying to recover it from the soluble fraction after the lysis step. Additionally, I created a lysis buffer for sonication that is normal in all aspects except for the fact that I increased the salt concentration from 300 mM to 500mM in hopes that higher ionic conditions may reduce multimers that my protein are forming. In the second half of the week, I spent time expression my protein on a downscaled version compared to the upscaled expression that I have done in the summer. I grew up a starter culture, grew some bacteria up in 3 150mL flasks, and then induced the bacteria with IPTG so that they could express my protein. I successfully spun down 3 separate protein pellets that will all be used for lysing with the 3 different solutions that I made earlier in the week. I will perform this lysing step next week, and then I will run the protein SDS-page gel to see how my different lysing conditions fared. On a side note, I also transformed some more BL21 cells with my FABI+pNIC plasmid because when I made a starter culture, only one of the colonies I used worked in one flask, but the colony used in the other flask were apparently dead. So I figured it's always nice to have some fresh bacteria with my vector in it for future expressions.
Figure 1: 40 ng of FABI+pNIC-BSA4 plasmid transformed into 25 uL of E. Coli BL21 competent cells on Kan+Suc plates. Notice that the transformation went smoothly and was done because my plates from the summer are considered too old now.
Figure 2: 10 mL B-Per lysis solution at a pH of 5.05 and 8.63. Along with these solutions, a lysis buffer for sonication was also made with all conditions for a normal sonication buffer kept the same besides increasing the NaCl concentration up from 300mM to 500mM.
Figure 3: Three BL21 cell+ FABI protein pellets that were expressed and stored in the -80 degree Celsius freezer for lysis in the upcoming week by the different lysing solutions that were described in figure 2.
100112 - Daniel, ok - making progress (not sure if it is forward or backward progress!) but hopefully your modifications to the purification may lead to soluble protein. Let me know if SHACKLETON is still misbehaving (bad cat!) - and I can send it back to Ocean Optics/Vernier. -- Dr. B
092812
Figure 1: WBM FabI enzyme assay with snap frozen enzyme from summer protein expression. The blue line is a 400 uL solution of 392 uL Tris 7.5 pH buffer and 8 uL of NADH substrate. Notice the blue line compared to the blue line of last week's figure 1. There is a ten-fold reduction in the amount of absorbance that is being read by the spectrophotometer at 340 nm. The red line is a second run with another fresh tube of NADH (just like the blue line run). Notice that the absorbance is even less, but this shouldn't make sense since the NADH was only a few days old and frozen at the same time. The green line represents 384 uL of buffer, 8 uL of NADH substrate, and 8 uL of Crotonyl-CoA cofactor. The absorbance did decrease in the presence of the cofactor, but the trustworthiness of this is shaky, just as the rest of the data in this figure. (Read on the 'Shakelton' spectrophotometer).
Figure 2: WBM FabI enzyme assay with glycerol enzyme from summer protein expression. The red line represents a 400 uL solution of 392 uL Tris pH 7.5 buffer and 8 uL of NADH substrate. This 340 nm absorbance reading should be shown with a much higher reading for the NADH substrate instead of a 0.000 reading. This shows that the Shakelton RedTide spectrophotometer is not working properly.
Figure 3: WBM FabI enzyme assay with glycerol enzyme from summer protein expression. The red line represents a 400 uL solution of 392 uL Tris pH 7.5 buffer and 8 uL of NADH substrate.This 340 nm absorbance reading of around 0.62 is more respectable and reasonable than in Figure 2. The blue line shows the reaction when represents 384 uL of buffer, 8 uL of NADH substrate, and 8 uL of Crotonyl-CoA cofactor. The absorbance did decrease in the presence of the cofactor, but it should have gone to 0 as all of the NADH was eaten up by the enzyme in the presence of the cofactor. But when more diluted enzyme was added in small amounts the absorbamce actually decreased. This led to the green line in which the same initial conditions as the blue line were introduced, but after a minute, 200 uL of stock (glycerol) enzyme was placed into solution. The absorbance of NADH immediately decreased to 0, which was what should happen. Then after 3 minutes, 8 uL more of NADH was added and the absorbance spiked as it should. Then the last 2 dips in the green line are 50 uL of stock enzyme being added to solution. As can be seen, the introduction of more enzyme yet again decreases the absorbance of NADH. The orange line represents a continuation of the green line, but now from 5-10 minutes. The introduction of other various factors was added to the solution. More enzyme was added, and more Crotonyl-CoA cofactor was added when the sharp dips in the graph are shown. (Used spectrophotometer Henry).
This week was a much better week in terms of success. I ran another enzyme assay with some of my snap frozen protein. This was initially unsuccessful because the Shakelton spectrophotometer was used. This was proven when a fresh sample of NADH was taken and there was no absorbance being read at 340 nm. This problem was solved by using the Henry spectrophotometer instead. But Henry showed the same results as last week initially (back when Shakelton was working I guess). The results were that the reaction of the degradation of NADH by FabI in the presence of Crotonyl-CoA partially decreased the absorbance of NADH, but didn't fully take it to 0. This was solved by adding more stock enzyme with everything else still the same as before. What resulted was that the absorbance of NADH at 340 nm shot straight down to 0. This proved the functionality of my enzyme. The only problem was that there just was so little enzyme after FPLCing. By adding more, the functionality of my enzyme was confirmed.
092112 - Daniel, ok at least there is hope that they assay might work if you get a good protein sample. -- Dr. B
This week's work in the lab proved to be another setback in the overall process of searching for novel inhibitors for my WBM FABI protein project. I spent Tuesday afternoon working with Michael to make dilute enzyme, substrate, and cofactor in order to perform an enzyme assay. In this assay the purpose was to check whether my enzyme was functional or not. I measured the absorbance at 340 nm because that is the wavelength at which the substrate NADH gives off the best signal. In Figure 1 below, results were as expected. I expected that there would be a high but constant signal because all there was in the solution that was being measured was NADH and the FABI enzyme. Figure 2 also yielded expected results because all there was in the solution was my enzyme and Crotonyl-CoA, which is a cofactor that helps catalyze the reaction of the FABI enzyme. With no NADH present in solution, there shouldn't be any signal at 340 nm. Figure 3 is where things went down the drain. With both the cofactor and NADH in the solution along with my reductase enzyme, the enzyme should have began eating up NADH in the presence of the cofactor. So what should have been expected was that the absorbance slowly tapered off to a reading of zero as the enzyme degraded all of the NADH, thus there being no more NADH to give signal at 340 nm. Figure 4 was placed in the same conditions as Figure 3, except with double the amount of NADH and cofactor involved. What I found interesting is that the NADH signal was reduced by more than half when in the presence of the Crotonyl-CoA. This must mean that the enzyme was somewhat functioning in reacting with the NADH in the active site, but it wasn't completing the degradation of NADH at a very fast rate because it can be seen that the orange line representing the absorbance reading of NADH in Figure 3 never really decreased. There are two possibilities that are going through my mind at this point. Either the FABI enzyme really isn't functioning properly, or the enzyme just didn't exist in the first place. What I mean by that is that I have been having trouble with my protein expression, and after FPLC, there is practically no protein left to be collected. If the protein formed multimers, it wouldn't be functional. There is no telling if I actually collected a sufficient amount of protein, or if it was even the correct protein after FPLC. This is why I need to figure out a way to get my protein to stay in the soluble fraction after spinning down. Next week I am going to do some research into journal articles to try to see if I can do anything to get my protein to solubilize. I have a feeling that my protein isn't very friendly with common pH values, so I may just take a shot in the dark and try expression and other things at different pH's in the future.
Figure 1: Blank with 100 uL of protein stock of 200 ng/uL, 292 uL of 100mM Tris at pH 7.5, and 8 uL of 5mM NADH substrate working solution. Notice that a absorbance is measured at 340 nm, which is the wavelength at which NADH emits signal. A high straight line absorbance (blue line) should be expected in this situation because NADH is present in a constant amount.
Figure 2: Blank with 100 uL of protein stock of 200 ng/uL, 292 uL of 100mM Tris at pH 7.5, and 8 uL of 12.0 mM Crotonyl-CoA cofactor working solution. Notice that the green line at the bottom with an absorbance of 0 at 340 nm. This should also be expected because Crotonyl-CoA gives off no signal at this wavelength, and since there is no NADH present, there should also be no signal.
Figure 3: Positive control 1 with 100 uL of protein stock of 200 ng/uL, 284 uL of 100mM Tris at pH 7.5, 8 uL of 5 mM NADH working solution substrate, and 8 uL of 12.0 mM Crotonyl-CoA cofactor working solution. Since there is NADH in the solution, there should be signal at 340 nm (orange line), but the signal should go down to zero because the cofactor Crotonyl-CoA is present. When both the substrate and cofactor is present, the substrate gets eaten up by the reaction that is catalyzed by FABI in the presence of Crotonyl-CoA.
Figure 4: Positive control 2 with 100 uL of protein stock of 200 ng/uL, 268 uL of 100mM Tris at pH 7.5, 16 uL of 5 mM NADH working solution substrate, and 16 uL of 12.0 mM Crotonyl-CoA cofactor working solution. Since there is NADH in the solution, there should be signal at 340 nm (purple line), but the signal should go down to zero because the cofactor Crotonyl-CoA is present. When both the substrate and cofactor is present, the substrate gets eaten up by the reaction that is catalyzed by FABI in the presence of Crotonyl-CoA. Since more NADH was added, there was a higher signal than in Figure 3, and since the enzyme was not functional with Crotonyl-CoA added, the absorbance stayed the same.
091212 Lane 1: Pageruler prestained protein ladder Lane 2: Sample 1 of Flask A (normal amount 500mM of IPTG added) after induction Lane 3: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer. Grown in 500mM IPTG Lane 4: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer & 2mM TCEP. Grown in 500mM IPTG Lane 5: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer & 10mM TCEP. Grown in 500mM IPTG Lane 6: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer. Grown in 250mM IPTG Lane 7: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer & 2mM TCEP. Grown in 250mM IPTG
Lane 8: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer & 10mM TCEP. Grown in 250mM IPTG
Lane 9: Soluable fraction, after lysing in B-Per buffer. Grown in 500mM IPTG
Based on these results, it can be seen that despite efforts to reduce multimers, my FABI protein is still mainly being lost in the soluble fraction step. It still seems as if the protein isn't being released from the cell properly after the cell is lysed through the sonication process. It seemed as if the B-Per lysing solution worked better than sonication did. The B-Per lane of the gel showed at least a considerable amount more of a protein band than the sonicated lanes of the gel. This makes me believe that although multimers may still be a problem, there might be a larger problem than just the multimers. It seems to me that perhaps the lysing of the bacterial cells that were induced to create my protein could be the core to the problem of losing most of my protein after spinning down and collecting the soluble fraction. Another consideration may be that my protein is just somehow insoluble in an aqueous solution that predominately contains water. My next step from here is to continue and perform an enzyme assay to test for the activity of the small amount of FABI protein that made it into the soluble fraction on my previous expression attempts over the summer. At the same time, I will be looking at papers and journal articles that have anything to do with the expression of a FABI enzyme in another organism, or another similar reductase.
090712 - This week I prepared for a small scale protein expression that I will perform next Monday. I made two SDS-page gels, autoclaved LB and allocated to LB appropriately to separate Erlenmeyer Flasks. I also transformed BL21's with the pNIC-BSA4 plasmid with my gene cloned within the plasmid. I also created three different lysis buffers that contain different amounts of TCEP. I created a B-per lysis solution as well, which will replace sonication as the primary form of lysing the bacteria. I am doing this in order to try to find conditions in which my protein will not be stuck at the bottom cell pellet when centrifuging after sonication and retaining the soluble fraction.
070212 - Daniel - great results. I am going to be so excited on the day when you 'flip' your page to reverse chronological order. I can't wait....we'll have fireworks and champagne! -- Dr. B
062112 - Dnaiel. Glad you got the pGFP pcr to work. Your results and postings look great. You can put them in reverse chronological order - just separate by a line break or a date entry. -- Thanks, Dr. B
7/25/12
Measure 1 of the OD of my FABI gene after purification. Absorbance looks decent, which will yield about 4.5 mg of protein. But there is no telling how much of my actual WBM FABI protein will be present after FPLC. Measure 2 is shown below.
7/17/12 Hypothesized sequence of FABI inserted into pNIC-BSA4 Vector
7/17/12 DNA sequencing Sample 6 Forward NNNNNNNNNNNNNNNCTTTAGANGAGATATACATATGCACCATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGGCGATTTCTCTGCTGCAGGGCAAAAAAGGTCTGATCACCGGCATTATCAAAAACGTTCTATCGCGTACGGTATCGTTAAAACCCTGAGCGAACATGGTGCAGAATCTGCGGTTACCTACCAGAACGAAATCGTCAAAGAACGTCTGCTGAGCATTGCCGCGGAACTGAACGTTGAACTGGTTCTGAACTGCGACGTTGCGAACGAAGGTACCATCGACGACGTTTTCAAATCTATCGAAGAAAAATGGGGTACGCTCGACTTTCTGGTTCACGCAATCGCATTCTCTGACAAAAACGAACTGTCTGGTAAATACGTTAACACCTCTCTGAACAATTTCCAAAACGCCATGAACATCTCTTGCTACTCTTTCACTGCGCTGGCGCAACGCGCTGAAAAGATGATGCCAAATGGTGGTTCTCTCCTGACGCTGTCTTACTACGGTGCGGAAAAAGTTATGCCGAACTACAATGTTATGGGTCTGTGCAAAGCGGCTCTGGAAGCGTCTGTTAAATACCTGGCGTGCGACCTGGGTCCGCAGAACATCCGTGTAAACGCGATCTCTGCGGGTCCGATCCGTACCCTGGCGAGCTCTGGTATTTCTGACTTCCACTTCATCAGCGAATGGAACCGTAACAACTCTCCGCTGCGTCGTAACACCACCCTGGAAGACGTTGGTAAAGCCGCCCTGTACCTGCTGTCTGACCTGTCCTCTGGCACGACGGGTGAGATCCTGCACGTTGACTCTGGTTACAACGTAGTTGGTATGAAAGCGATCGATTCTAACATCATTAATTCTTACCAAAATTGACAGTAAAGGNGGATANGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCANCACCACCACCACCACTGAGATCCNGCTGCTAACNAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCNCGCTGANCATANTAGCATNACCCCNNGGNNNCTAAANGGNNTTGANGGNTTTTGCTGAAAGNGANTATNTCNNTGNNANGGGNNNNNNCCNGNNNNGNNNNTNNNNNNNNNGNNNNNNNCNNNANNNNNCNNNNNNNNNAGNNNCNNNNNNNNNNN NNNNNNTTNNNNCGNNNNTNCNNNNNNNNNNNNANNNNNNN
*Notice that the entire FABI gene is included in this sequencing forward read, without any deletions or insertions
7/11/12 Figure 1: Image of Sample 1 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 2: Image of Sample 2 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 3: Image of Sample 3 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 4: Image of Sample 4 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 5: Image of Sample 5 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 6: Image of Sample 6 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 7: Image of Sample 7 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 8: Image of Sample 8 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
PNIC Accepting vector RE DIGEST
Lane 1: Skip
Lane 2: 100 bp DNA ladder, but there should have been a 1 kb ladder
Lane 3: Michael RE digest of pNIC-BSA4 accepting vector (from top to bottom, multimer band, uncut plasmid, two cuts of the pnic plasmid)
Lane 4: Daniel RE digest of pNIC-BSA4 accepting vector (from top to bottom, multimer band, uncut plasmid, two cuts of the pnic plasmid)
Lane 5: Andrew RE digest of pNIC-BSA4 accepting vector (from top to bottom, multimer band, uncut plasmid, two cuts of the pnic plasmid)
Measure of pNIC-BSA4 accepting vector take two
070212 Measure 1 of pNIC-BSA4 accepting vector
Measure 2 of pNIC-BSA4 accepting vector
As it can be seen, the prepared pNIC accepting vector that was cleaned up via PCR cleanup didn't yield a high concentration of pNIC gene, but it can still perhaps be used. Instead of risking transformation with this low concentration of pNIC, I went ahead and re-did my pNIC preparation and yielded about twice the concentration of pNIC plasmid DNA as shown below. This was the DNA that I used for annealing and transformation.
062712
Lane 1: Skip Lane 2: 100 bp DNA ladder Lane 3: Daniel PCR squared Lane 4: Daniel PCR squared Lane 5: Daniel PCR squared Lane 6: Daniel PCR squared
Note: This second try at my PCR squared worked. Much more amplification of DNA and much less contamination. The high amplification of DNA shown below by nanodrop results.
Measure 1
Measure 2
062712 Lane 1: Skip Lane 2: 100 bp DNA ladder Lane 3: Daniel PCR squared Lane 4: Daniel PCR squared Lane 5: Daniel PCR squared Lane 6: Daniel PCR squared Lane 7: Michael PCR squared Lane 8: Michael PCR squared Lane 9: Michael PCR squared Lane 10: Michael PCR squared
My PCR squared didn't work as well as I would like to. There was contamination (shown as the bottom bands in the lanes), and there was not much amplified WBM FabI DNA. This is confirmed through the PCR cleanup of these samples in Lanes 2-6, where the nanodrop results yielded a low concentration.
Measure 1 Measure 2
062212
Lane 1: Skip Lane 2: 100 bp DNA ladder Lane 3: Daniel secondary PCR overlap (with my own diluted 20 uM forward and reverse primers) (10x ThermoPol buffer, 25mM MgSO4. 2mM dNTPs, 1uM Oligo Mix from primary PCR, KOD polymerase, Autoclaved water, 20um Forward and Reverse Primers) Lane 4: Skip Lane 5: Skip Lane 6: Rishi Secondary PCR overlap
062112 Lane 1: Skip Lane 2: 100 bp DNA ladder Lane 3: Michael Primary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, Autoclaved Water) Lane 4: Michael Secondary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, 20 uM Forward and 20 uM Reverse Primers, Autoclaved Water) Lane 5: Max Primary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, Autoclaved Water) Lane 6: Max Secondary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, 20 uM Forward and 20 uM Reverse Primers, Autoclaved Water) Lane 7: Daniel Primary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, Autoclaved Water) Lane 8: Daniel Secondary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, 20 uM Forward and 20 uM Reverse Primers, Autoclaved Water)
062112 Lane 1: Skip Lane 2: 100 bp DNA ladder Lane 3: 0.0824 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Daniel Lane 4: 0.824 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Daniel Lane 5: 8.24 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Daniel Lane 6: 0 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Daniel Lane 7: 0.0824 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Michael Lane 8: 0.824 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Michael Lane 9: 8.24 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Michael Lane 10: 0 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Michael
Note: This pNIC-BSA4 pcr worked because this time the pLIC primers were diluted to a proper 2.5 uM working solution.
062012
Note: This pcr failed because it required a working solution of forward and reverse pLIC primers of 2.5 uM, but we accidentally used the stock solution of the primers of 100 uM.
Lane 1: 100 bp ladder Lane 2: 0.00824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) -Daniel Lane 3: 0.0824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) - Daniel Lane 4: 0.824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) – Daniel Lane 5: 0 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) – Daniel Lane 6: 0.00824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) - Kaarthik Lane 7: 0.0824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) - Kaarthik Lane 8: 0.824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) – Kaarthik Lane 9: 0 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) – Kaarthik
PCR - pGFP Lane 1: Skip Lane 2: 5 ul 100 bp ladder Lane 3: 0.016 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, VDS 1 (forward) and VDS 2 (reverse) primers) Lane 4: 0.16 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, VDS 1 (forward) and VDS 2 (reverse) primers) Lane 5: 1.6 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, VDS 1 (forward) and VDS 2 (reverse) primers) Lane 6: 0 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, VDS 1 (forward) and VDS 2 (reverse) primers) Lane 7: 0.016 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, M13 (forward) and M13 (reverse) primers) Lane 8: 0.16 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, M13 (forward) and M13 (reverse) primers) Lane 9: 1.6 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, M13 (forward) and M13 (reverse) primers) Lane 10: 0 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, M13 (forward) and M13 (reverse) primers)
*As it can be seen, the VDS primers produced bands that were much higher up and much more distinct on the gel than the M13 Primers. It was good to see that lanes 6 and 10 both had the faintest bands because there was no DNA template added to these wells, but there may have been residue DNA from the other wells that may have found its way into lanes 6 and 10, which produced the barely visible bands. As was expected, the bands sort of gained intensity with the amount of pGFP plasmid that was introduced to each sample well, but I would have liked to see more of an intensity gradient in the bands. It is still interesting how the bands for the M13 primers were much lower on the gel than with the VDS primers. Dr. B told me that all the bands should be in about an uniform position on the gel, so I should follow up on why the lack of uniformity occurred.
062112 - PCRs look good - you could crop these images a little more aggressively so that the detail could be seen better -- Thanks, Dr. B
PCR-pGBR22
Lane 1: Skip
Lane 2: 100bp DNA ladder
Lane 3: 1 ul of 0.3 ng total pGBR22 plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP's, Taq, M13 Forward and Reverse Primers)
Lane 4: 10 ul of 3.0 ng total pGBR22 plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP's, Taq, M13 Forward and Reverse Primers)
Lane 5: 10 ul of 3.0 ng total pGBR22 plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP's, Taq, M13 Forward and Reverse Primers)
Lane 6: 0 ul of 0.0 ng total pGBR22 plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP's, Taq, M13 Forward and Reverse Primers)
Transformation of pGFP
Figure 1: After incubation of DH5alpha with 1 ng of pGFP (1.58 lambda) plasmid transformed into the E. Coli bacterial cells.
Figure 2: After incubation of DH5alpha with 5 ng of pGFP (1.58 lambda) plasmid transformed into the E. Coli bacterial cells.
Figure 3: After incubation of DH5alpha with 25 ng of pGFP (1.58 lambda) plasmid transformed into the E. Coli bacterial cells.
Note: As it can be seen, there was not a significant difference in the amount of bacterial DH5alpha bacterial colonies that showed up on the plates. It was expected that as the amount of the pGFP plasmid (in nanograms) was transformed into the bacteria, the more colonies would appear. This theory was proven to be false because of the amount of total tube contents that was plated. Because not a small amount of tubular content was plated, a huge amount of bacteria grew in the plates overnight, thus proving quite hard to count the total number of bacterial colonies to test for a significant increase in transformation efficiency.
From left to right, 1KB ladder, EcoRI, PvuII, EcoRI+PvuII bands expected based on Analyzing DNA sequencing lab.
As it can be seen, the bands from my gel showed up mostly as expected. A band at about 3kb appeared in lane 3 (uncut plasmid), which was about the same position as the single band in the EcoRI lane 4. This should be expected because the EcoRI cut the circular uncut pGBR22 plasmid into a linear gene, but there is still one gene fragment that should be of equal size as the uncut plasmid. Lane 5 should show 2 distinct bands in the gel according to the theoretical image above. After experimenting, two bands did show up in about the same position as hypothesized when the PvuII was added. When both PvuII and EcoRI was added (lane 6), three bands should be shown to distinguish 3 cuts in the plasmid which create 3 fragments of the DNA. In my experimental gel, two and a half bands showed up in the correctly hypothesized spots. The one band that did not completely show up in my gel could be because the gel electrophoresis was not allowed long enough to run, or it could have been because of my pipetting skills when adding the liquid to the well of lane 6.
061212 - Daniel, I think that 'missing' band is really there - it is just too weak to distinguish on the gel. But you can see a shift in the band above indicating that there was another piece cut. --DR. B
*Forward DNA sequencing results of pGBR22 plasmid through use of the M13For-20 primer
NNNNNNNNNNGANNATAGANTACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGC
CGCACTAGTGATTTTGATTGATTGAAGGAGAAATATCATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGT
CAGGCACGGTCAATGGACACTACTTTGAGGTCGAAGGCGATGGAAAAGGAAAGCCTTACGAGGGGGAGCAGACGGTAAAG
CTCACTGTCACCAAGGGTGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACTGTCTCAATACGGAAGCATACCATT
CACCAAGTACCCTGAAGACATCCCTGATTATGTAAAGCAGTCATTCCCTGAGGGATATACATGGGAGAGGATCATGAACT
TTGAAGATGGTGCAGTGTGTACTGTCAGCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACAATGTCAAAATCTCT
GGTGTGAACTTTCCTCCCAATGGACCTGTTATGCAGAAGAAGACACAGGGCTGGGAACCCAACACTGAGCGTCTCTTTGC
ACGAGATGGAATGCTGATAGGAAACAACTTTATGGCTCTGAAGTTGGAAGGAGGTGGTTACTATTTGTGTGAATTCAAAT
CTACTTACAAGGCAAAGAAGCCTGTGAGGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAGTCACAAC
AAGGATTACACATTTGTTGAGCAGTGTGAAATATCCATTGCACGCCACTCTTTGCTCGGTCATCACCATCACCATCACTA
AAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTG
GCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGC
CAGCTGGCGTANTAGCNANANGCCCGCACCGATCGCCCTTCCCANCAGTTGCNCANNNNANGGNNATGGACNNNCCTGNA
GNGNGCATNNCNCGGNNGNNGTGGNNGNNCNNNCAGCGNGANNCTACNNNNCAGCNNNNNCNNNNNCNTNNGNNNNNNTN
NTNNNNGCNNNTNNCNNNNNTNANNNNNNNGGGNNNNNNNNNNCNANTTANNNNTNNNNNNCNNNCNNNNNNNNNNNGGN
NNNNNNNNNNNGNNNNNNNNNNCCNNNNNANNNNG
*Reverse DNA sequencing results of pGBR22 plasmid through use of the M13Rev-20 primer
Figure 1:Measurement 2 of pGFP bacterial DNA for absorbance at 230 nm. Concentration of plasmid is shown in bottom right green box at 935.4 ng/uL. Actual concentration of plasmid was 1580 ng/uL.
Figure 2:Measurement 1 of pGFP bacterial DNA for absorbance at 230 nm. Concentration of plasmid is shown in bottom right green box at 1012.4 ng/uL.
Actual concentration of plasmid was 1580 ng/uL.
This week in lab, I got my DNA sequencing results back. It was found that the forward sequence was about the right gene size (about 1170 bp) as Wbm DXR, but the bad news was that there were many 'N' misreads in the forward read of the sequence. Perhaps I should have used more of the PCR cleanup DNA when sending to sequencing, but according to the PCR cleanup nanodrop results, I didn't need a large volume of DNA to equal 500 ng that was needed to send to DNA sequencing. The reverse read of the DNA sequencing results came back with only about 550 base pairs, which is a lot less than the Wbm DXR gene, and there were also a lot of misreads in the DNA sequence. After a nucleotide BLAST, it was found that the forward read matched up best to the chromosome of a foreign bacteria that I have never heard of. In fact, no Wolbachia gene or DXR gene was in the top results of the BLAST. This meant that the secondary product that I further amplified was not the correct Wbm DXR gene. So I decided to try one last PCR attempt this week before the semester ended. In this attempt, I changed only the annealing temperatures to 59, 60, and 61 degrees Celsius, which I never have used before. The same primary PCR template that worked a few weeks ago was still used as the template to build the secondary PCR product off of. Once again, none of the different conditions mattered because no correct gene was synthesized. Perhaps the primary PCR template was getting old since it is a few weeks old, but since the semester has ended, I'll never know if that was the case. Along with these things, I also participated in cleaning up the lab and writing my final research report this week.
120412
Figure 1: Secondary PCR trials under many different conditions. The secondary PCR mixture was created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary/secondary PCR mixture, 1 uL of 20 mM custom forward tail primer, 1 uL of 20 mM custom reverse tail primer, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. The changes done to this PCR attempt were the temperatures used to anneal the primers at. Also, since the third lane was performed at the VDS protocol recommended 58 degrees Celsius annealing temperature, it was decided that only this PCR reaction was to be done at the extended [1] DNA Works PCR conditions. As the gel shows, none of the secondary PCR reactions formed a distinct band, and the 58 degree Celsius extended PCR reaction seemed to almost form a primary smear, which is not what was expected.
Lane 1: Skip
Lane 2: 100 bp ladder
Lane 3: Secondary PCR Wbm DXR gene created off of primary PCR template and under extended [1] thermocycler conditions listed in the VDS protocol, with a 58 degree Celsius annealing temperature used
Lane 4: Secondary PCR Wbm DXR gene created off of primary PCR template and under normal thermocycler conditions listed in the VDS protocol, except a 59 degree Celsius annealing temperature was used
Lane 5: Secondary PCR Wbm DXR gene created off of primary PCR template and under normal thermocycler conditions listed in the VDS protocol, except a 60 degree Celsius annealing temperature was used
Lane 6: Secondary PCR Wbm DXR gene created off of primary PCR template and under normal thermocycler conditions listed in the VDS protocol, except a 61 degree Celsius annealing temperature was used
[1] Hoover, D. M.; Lubkowski, J., DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. Nucleic Acids Res 2002, 30 (10), e43.
Figure 1: Nucleotide NCBI BLAST of sequencing results of the forward read of the PCR cleanup that was done on the Wbm DXR gene previously. The BLAST was done against the all nucleotide collection database, and the most similar sequences were not sequences from organisms that were Wolbachia. As a matter of fact, not even a DXR gene from another organism appeared as a similar sequence. This could be due to the fact that there were a lot of ‘N’ nucleotides that could not be read by the DNA sequencer. The reverse read didn’t read more than about 550 nucleotides, and there were a lot of ‘N’ nucleotides within.
Figure 2: Pairwise nucleotide comparison of the most similarly found sequence to the forward read sequencing result of the Wbm DXR CDS. The organism was Agrobacterium sp., and the similar sequence came from one of its circular chromosomes. There was a 66% query coverage, for the Agrobacterium gene was a lot smaller than the 1170 bp Wbm DXR gene. There was also a 66% max identity for this sequence. The low quality read of the sequencing results may be to blame for the wonky results. It should be noted that trying to align the codon optimized sequence of Wbm DXR to these sequencing results yields ‘no significant similarity found’.
NNNNNNNNNNNNNNNGNNNNNNNNNNNNNGNNNNANNNNNNNNNNNGAGGNNNNTTCGGNGCNGNNNNGTGNNNANCAGNNGN
CCGCGGNCGTCGTCGAGGTGGCCCGCGGAGNNGNNGGGAAGGTTGNCNNGGGNGNNNNAGCCNGCTNNNNGCNGGNGGGGG
AGGCTGGCCTGGAGGTCNAGCCGGGNTCGAAGGTCTTCCAGGGNGNCGTGCTGGGAGGCTCGCCGGGGGTGGANGCCCAGGTT
AAGGAAATCNGCGGGGGTCCGCCGGGCGTTGCCAAGGTGGACGAAGCACGTGNNCCGAANGATCACGCCGNCNNGGCNGAGTT
CAANGGNACCATCCGCCTGGNTCGCNNNNACNACAAAGGGGGTCGCGTGATGAGCGGGCCTGCGGAAGACCGCNTCNAGCCGG
TCAAACACCTTATCCCAAANGNCAGGCCCTTCCNTCTTCNGANNGCNACTACNTCAAGAAGGGNNAATACNTTCTNNACNGCNNNNC
GGCNANNCAAGNNNTTCTGNCNNTNNNNGGCNTGTTNNCTCTGGCTTCCTACCTNGTNNNCNAANTCCANGANNTCNACCGACTGAN
NGGCNTTNTGATCANNGACNNGCACNTCNAGGTGATNNTTCNCNNNATGCTGCANANNGTTNANATCACNNATGCCTGCNACTGCCA
GTACATCNTCNNCNACNACNTCNANNNNATCAAGCTNNANNACNTGAACNACNNGCTGATCNACGANNNCCANAANNCCNNNTTACN
GCNANNCTGTTCTGCTNNGCATCNNNNNCGCTTCGCTTCNNNCCCNNCTCTTCATTTNNNCCGCATNNCNTCCANGANACCACCANNG
TTCTCACNNATCTGCNATTGCCNNCNATACNNANACTCTNCAGGGNCTNNNNNAAAACGTCNTCATCNGNNNTNTCATNCCGGCCNNT
ACTGGAGGCNCCNTGACNCATATCCNCNNNNNNNNNCNTCNCGCGACNANNNNNTNNNGNANGANCNNNNNAGGGNTACGGNNNN
CNGTTCTNGCAANCANNTNNNNNGNNNTNGACTGANNAGNTCCGGNCCNNNNANNNNGNNAANNANNNNANNGGCNTGGNCTNNNN
ANNNNCNNNNNNNTCNNNANNANNNCGNNNNNNNNNNNNGNNNNNNNNNNNNTNNNNNNNGNNNNNNNNNCNNNNN
Figure 3: Forward read by the DNA sequencer for the Wbm DXR gene which was synthesized and PCR cleaned up earlier last week (the abnormal 118 ng/uL concentration). Notice that there were a lot of misreads (N) in the gene sequence readout, and this may have lead to bad nucleotide BLAST results.
NNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNCGGAAATTTTCTTCATNGGATTGNGAAGTACAGAACGGAAATTTTCTTCATGGA
TTGGAAGTAAAAAAGGGATTTTTTCTTTGGGNNNTGTGNATAANNNNNNNATTTTGCCNGNGTTGCTTGTTGAANTCNNGGANATCGGC
GGCCGCNNNCCNNNCANCCNCTTGTGCCNNTCCTNNNNNTANCGNNCAAACCGCCGNACGTGNNTCATCGGCNNTNNNNNNANCNAT
CATNANAATCCCNNNNNNNTACNGNGNCGAGNGACAAATCCCGTCAGAANNNCATAATGGCTTTTGGCCGTCTCACCATCNGAGNAC
GACATANCNGCCGGCCTGAGNNCNNNNTNNNNCNNNAGNNGTNNNNGGNNANNCNNNTNNNCNNNANNTGNNNNGNNGNCCTNNNN
CNCTCTNTTGGCCNNNTNNNNGANGAGNGGNNCGNAANNCNNNNNTNNTTTTTTCNAATTNTCNNCANCTAANNNNNTTTNTNNNTTCCN
CCTGNNTCCNGCANTNNNNTNTCTN
Figure 4: Reverse read by the DNA sequencer for the Wbm DXR gene which was synthesized and PCR cleaned up earlier last week (the abnormal 118 ng/uL concentration). Notice that there were a lot of misreads (N) in the gene sequence readout, and this may have lead to bad nucleotide BLAST results. Also, there was only about 550/1170 nucleotides that should have been read.
120212
The University of Texas at Austin
College of Natural Sciences - Office of the Dean
1 University Station G2550
Austin, TX 78712
This week in lab I tried many different PCR techniques in order to attempt to produce a viable secondary PCR product. First, I attempted secondary PCR off of a previously determined successful primary PCR with custom tail primers at 58 and 62 degrees Celsius annealing temperatures, and I also tried to use the first/last and 3rd/28th oligonucleotides as primers instead of tail primers at the same annealing temperatures. The theory was that the oligonucleotides should've binded to the fully synthesized correct gene fragment that resided in the primary PCR product and thus amplify the correct gene with oligo primers instead of custom tail primers whose ends were made to fit the gene into a pNIC-Bsa4 vector. A pUC-19 cloning vector could then be used to clone into, and then the pNIC-Bsa4 expression vector could then be used, but the oligo primers didn't seem to work out in creating a secondary PCR product. This could have been because the annealing temperatures for the single oligonucleotide primers wasn't optimal, or there may have been something totally wrong with the way the primary PCR was synthesized originally. Either way, I still continued to perform a secondary PCR reaction off of the one secondary PCR product that worked from what I explained above (tail primers at 58 degree Celsius annealing temperature). Although the secondary band was feint and seemed to appear a little bigger on the gel than the actual WbmDXR gene size (about 1200 bp), I decided to perform many other secondary (not really PCR squared, but the secondary reaction of the secondary product) reactions at different conditions in order to try to further amplify the gene. I tried to perform normal protocol secondary PCR at 57 degrees Celsius annealing temperatures and this seemed to produce somewhat successful secondary product. Secondary PCR done at 58 degrees Celsius annealing temperatures didn't seem to work this time even though that was the temperature used to create the band in which was now the template for the secondary of the secondary PCR reaction in the previous PCR mentioned above. The 62 degree Celsius annealing temperature worked for the normal thermocycler conditions listed in the VDS protocol, but not for the suggested DNA works journal article's extended thermocycler condition protocol. This suggestion was used in for a 58 and 62 degree Celsius annealing temperature PCR reaction, but neither seemed more successful than the normal VDS protocol PCR thermocycler conditions. Lanes 3, 4, 5, and 9 from the gel in Figure 2 were combined, PCR cleaned up, and sent to DNA sequencing. The nanodrop concentrations of the initial 138 uL total of lanes 3, 4, 5, and 9 that were eluted in 50 uL of Tris HCl are shown below and are abnormally high (especially since a true PCR squared reaction wasn't done). Next week I will await the results of the DNA sequencing to see if the proper gene was synthesized, and I will either look at a Gene Block method of ordering the correct gene (cheating), or I will try to order new oligonucleotides for the project with the tail primer sequences already incorporated into the first and last oligonucleotides. I may also consider trying to do another enzyme assay with what Fab I protein I have left in order to get some better raw data concentrations for my final report.
112812
Figure 1: First of two measurements for the concentration of PCR cleanup on four of the secondary PCR reactions that were done on the latest agarose gel. The remaining 38 uL (after running an initial gel check) of each of the secondary reactions used were Lanes 3, 4, 5, and 9 from the previous gel. The PCR product corresponding to each of these lanes was combined and underwent PCR cleanup. Notice that the concentration for this measurement is fairly high for a PCR cleanup, so until DNA sequencing results come back, this data should be taken with a grain of salt.
Figure 2: Second of two measurements for the concentration of PCR cleanup on four of the secondary PCR reactions that were done on the latest agarose gel. The remaining 38 uL (after running an initial gel check) of each of the secondary reactions used were Lanes 3, 4, 5, and 9 from the previous gel. The PCR product corresponding to each of these lanes was combined and underwent PCR cleanup. Notice that the concentration for this measurement is fairly high for a PCR cleanup, so until DNA sequencing results come back, this data should be taken with a grain of salt.
112712
Figure 2: Secondary PCR trials under many different conditions. The secondary PCR mixture was created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary/secondary PCR mixture, 1 uL of 20 mM custom forward tail primer, 1 uL of 20 mM custom reverse tail primer, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. The changes done to this PCR attempt were the temperatures used to anneal the primers at, the template used to build the secondary product off of, and the overall thermocycler temperature conditions and times.
Lane 1: Skip
Lane 2: 100 bp DNA ladder
Lane 3: Secondary PCR Wbm DXR gene created off of primary PCR template and under normal thermocycler conditions listed in the VDS protocol, except a 57 degree Celsius annealing temperature was used
Lane 4: Secondary PCR Wbm DXR gene created off of secondary PCR template which was mildly successful from 11.26.12 creation date and under normal thermocycler conditions listed in the VDS protocol, except a 57 degree Celsius annealing temperature was used
Lane 5: Same as Lane 4
Lane 6: Secondary PCR Wbm DXR gene created off of primary PCR template and under normal thermocycler conditions listed in the VDS protocol (58 degree Celsius annealing temperature used)
Lane 7: Secondary PCR Wbm DXR gene created off of secondary PCR template which was mildly successful from 11.26.12 creation date and under normal thermocycler conditions listed in the VDS protocol, except a 58 degree Celsius annealing temperature was used
Lane 8: Secondary PCR Wbm DXR gene created off of secondary PCR template which was mildly successful from 11.26.12 creation date and under suggested thermocycler conditions listed in the referenced article1, except with a 58 degree Celsius annealing temperature instead of the suggested 62 degree Celsius annealing temperature
Lane 9: Secondary PCR Wbm DXR gene created off of secondary PCR template which was mildly successful from 11.26.12 creation date and under normal thermocycler conditions listed in the VDS protocol, except a 62 degree Celsius annealing temperature was used
Lane 10: Secondary PCR Wbm DXR gene created off of secondary PCR template which was mildly successful from 11.26.12 creation date and under suggested thermocycler conditions listed in the referenced article1, and the suggested 62 degree Celsius annealing temperature was used
[1] Hoover, D. M.; Lubkowski, J., DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. Nucleic Acids Res 2002, 30 (10), e43.
112612
Figure 1: Secondary PCR results from primary PCR mixture that was successfully created a few weeks ago at a 58 degree Celsius annealing temperature. The secondary PCR mixture was created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary PCR mixture, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. The changes done to this PCR attempt were the primers used and the temperatures used to anneal them at. Notice that there was a feint band in Lane 3 representing the relative position in which the synthesized DXR gene would reside, but the band is not vibrant enough and isolated enough from any other contamination to be a solid candidate to run PCR squared on.
Lane 1: Skip
Lane2: 100 bp DNA ladder
Lane 3: Secondary PCR Wbm DXR gene with custom forward and reverse tail primers at 58 degree Celsius annealing temperature
Lane 4: Secondary PCR Wbm DXR gene with custom forward and reverse tail primers at 62 degree Celsius annealing temperature
Lane 5: Secondary PCR Wbm DXR gene with IDT ordered oligonucleotide #1 as the forward primer and oligonucleotide #30 as the reverse primer at 58 degree Celsius annealing temperature
Lane 6: Secondary PCR Wbm DXR gene with IDT ordered oligonucleotide #1 as the forward primer and oligonucleotide #30 as the reverse primer at 62 degree Celsius annealing temperature
Lane 7: Secondary PCR Wbm DXR gene with IDT ordered oligonucleotide #3 as the forward primer and oligonucleotide #28 as the reverse primer at 58 degree Celsius annealing temperature
Lane 8: Secondary PCR Wbm DXR gene with IDT ordered oligonucleotide #3 as the forward primer and oligonucleotide #28 as the reverse primer at 62 degree Celsius annealing temperature
112612
112612 - Good. Dr B
Freebee from last week's journal club!!!
111812
Daniel - well done! -- Dr. B 11/19/12
This week I continued with secondary PCR attempts on Urvashi's DXR target. I used the both the 57 and 58 degree Celsius annealing temperature primary PCR product that was successfully synthesized last week (shown in Figure 2 of last week) in order to try to successfully make secondary product with newly diluted forward and reverse tail primers. The end result is shown in Figure 1 below. There was basically no distinct secondary PCR band that represented the correct DXR gene size on the gel when taking the 57 degree Celsius primary PCR product and performing secondary at 58 and 62 degree Celsius annealing temperatures this time. There were also no distinct secondary bands when taking the 58 degree Celsius primary PCR product and performing secondary at 58 and 62 degree Celsius annealing temperatures with this other batch of successful primary PCR product. The thought was that one primary product may have been a better template to build the secondary off of than the other due to the one degree difference in annealing temperatures when synthesizing the primary. Apparently this made no difference because there was no overall success at creating a successful secondary PCR product. Next week, I will try to perform a secondary PCR with the first and last oligonucleotides instead of the tail primers. This will judge whether the tail primers are the reason for the lack of amplification of the primary PCR product. If this is the case, I will have to consider cloning into a PUC-19 cloning vector instead of straight into the pNIC-BSA4 expression vector. I also analyzed my results of the CB diversity set of ligands for the virtual screening of my Wbm Fab I homology model this week. It took about two weeks to run the job on 6 processors, and it didn't even completely finish before I had to kill it. But for the most part, about 35 k out of the 50 k ligands were screened, which is a good enough amount to analyze anyways. The results are shown in Table 1 below for the top 30 ligands that GOLD predicted to bind the best in the active site of my homology model. Lipinski's Rule and PyMol analysis was done and shown in Table 2. It seems as if the second top ranked compound may be a good possible drug candidate. The top ranked ligand is shown in Figure 2.
Figure 1: Secondary PCR results from my primary PCR mixture. The secondary PCR mixture was created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary PCR mixture, 1 uL of both 20 mM forward and reverse custom Wbm DXR primers that were newly diluted, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. 29 cycles of normal thermocycler conditions were used, including 58 (Lane 3/4) and 62 (Lane 5/6) degree Celsius annealing temperatures. As can be seen, the 100 bp DNA ladder showed up in Lane 2, but no viable secondary PCR band appeared in Lanes 3, 4, 5, or 6 when added and ran in 1x TAE buffer via gel electrophoresis for 45 minutes at 110 Volts.
Figure 1: Top ranked ligand by initial Run 1 GOLD virtual screening program in the active site of the homology model protein of the Wbm Fab I protein when viewed in PyMol. The homology model was made by Swiss-Model off of the template Fab I protein 3K31 (Anaplasma phagocytophilum). The active site was of this homology model protein was defined by superimposing the Thermus thermophilus (2WYW) Fab I protein onto the homology model and figuring out where its triclosan (TCL) compound was positioned (next to NADH substrate already in homology model active site). After removing the NADH and TCL ligands, the active site was defined within 7.5 Angstroms of the TCL ligand. This is compound 6433994 from the Chembridge diversity set library. The homology model protein residues are shown in a green carbon color scheme as surface. The compound 6433994 ligand is shown as sticks in a cyan carbon color scheme. Polar contacts between the ligand and the active site residues are shown as black dashed lines.
110812
This week I began work on Urvashi's Wbm DXR target. She was focusing on primary and secondary PCR's. So i decided to first try to use the Primary PCR mix that she said worked in successfully creating a nice secondary band about two weeks ago (but that secondary band didn't produce a good PCR squared for her). The results are shown below in Figure 1 with a standard 58 degree Celsius annealing temperature. The ladder showed up, but the secondary PCR product did not. So in hopes of starting fresh, I used a brand new oligo mix that Janice just made and ran primary PCR reaction at both 57 and 58 degrees of annealing temperatures. The primary results for both annealing temperatures seemed favorable based off the gel in Figure 2, but when a secondary PCR reaction was ran with the primary products that were produced, unfavorable results were found. With the 57 degree Celsius secondary PCR reaction that was run with the 57 degree Celsius primary product, two bands (one large and one small) showed up faintly, and these bands did not represent the DXR gene whatsoever. With the 58 degree Celsius secondary PCR reaction that was run with the 58 degree Celsius primary product, no visible bands even showed up. This leads me to believe that perhaps the annealing temperatures for the secondary PCR reactions need to be changed, or the primary and secondary reactions need to be ran again with hopes of less contamination appearing in the gel. Next week I will try to run another secondary PCR reaction from the favorable primary PCR products in Figure 2 at different annealing temperatures. If this doesn't work, I may have to start from scratch and make another primary PCR template that may be less contaminated in order to successfully run a secondary reaction.
Figure 1: Secondary PCR results from Urvashi’s primary PCR mixture which she said worked previously at 58 degrees Celsius annealing temperature. The primary PCR mixture was created on 10.19.12. The secondary PCR mixture was created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary PCR mixture, 1 uL of both 20 mM forward and reverse custom Wbm DXR primers, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. 20 cycles of normal thermocycler conditions were used, including a 58 degree Celsius annealing temperature. As can be seen, the 100 bp DNA ladder showed up in Lane 2, but no secondary PCR band appeared in Lanes 3 and 4 when added and ran in 1x TAE buffer via gel electrophoresis for 45 minutes at 110 Volts.
Figure 2: Primary PCR created from overlapping oligonucleotides of Urvashi’s DXR custom ordered (from IDT) are shown in Lanes 2 and 3. 30 cycles of normal thermocycler conditions were used, except a 57 degree Celsius annealing temperature was used on Lane 2’s primary PCR while a 58 degree Celsius annealing temperature was used on Lane 3’s primary PCR. Primary PCR mixture was created with created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of custom Wbm DXR oligonucleotide mixture, 1 uL of KOD hotstart Polymerase, and 35 uL of sterile water. Lane 4 represents secondary PCR made from the primary PCR mixture in Lane 2 with an annealing temperature of 57 degrees Celsius and all other portions of the 30 cycles of the thermocycler conditions normal. Lane 5 represents secondary PCR made from the primary PCR mixture in Lane 3 with an annealing temperature of 58 degrees Celsius and all other portions of the 30 cycles of the thermocycler conditions normal. The secondary mixtures were created with 5 uL of 10x KOD reaction buffer, 3 uL of 25 mM MgSO4, 5 uL of 2 mM dNTP’s, 1 uL of primary PCR mixture (from either Lane 2 or 3), 1 uL of both 20 mM forward and reverse custom Wbm DXR primers, 1 uL of KOD hotstart Polymerase, and 33 uL of sterile water. As can be seen, the 100 bp DNA ladder showed up in Lane 2, and both primary PCR’s showed a nice distinct smear that was expected. Lane 4 showed a feint band near the 500 bp range while Lane 5 showed no secondary PCR results. The band at Lane 4 must represent contamination because Urvashi’s DXR target is easily over 1000 bp in length.
110112
This week I focused on making myself a homology model and attempting to do virtual screening with that model. It was found that the template protein for my homology model was the Anaplasma phagocytophilum Fab I enoyl-acyl carrier protein (From Swiss-Model) (3K31). My WbmFab I homology model was built off this enzyme by Swiss-Model, and the program kept the NAD substrate from the Anaplasma phagocytophilum in the homology model protein, which was helpful to define the active site of my homology model. But when I was configuring my gold.conf file, Hermes didn't want to show the NAD substrate as anything other than disconnected atoms. So I spent a long time trying to sort out how I could extract the ligand and define the active site. I settled on deleting the atoms of the NAD ligand in PyMol and then superimposing the Triclosan (TCL) ligand that was in the active site of a similar Fab I protein from T. thermophilus onto my homology model and saving the TCL ligand within my homology model protein while deleting the rest of the T. thermophilus Fab I protein residues. This ligand was superimposed right next to where NAD once was (before deletion), so this is how I knew TCL was in the active site. Once this problem was solved, I proceeded to define the active site around TCL and then extracted the ligand as a .mol2 file. I first ran an initial GOLD run with the CB 306 library in order to see if the GOLD screening process worked. It ran for about 7 hours on 1 processor, and the top 10% of those ligands are shown in the table on Figure 3. I then ran a quick 1 ligand run with the extracted TCL ligand back in the active site of the homology model, which is shown in Figure 2. The GOLD score (shown in Figure 3) was not impressive, and it ranked very low compared to the top 10% ligands from the CB 306 library. This low score could be because the TCL ligand didn't line up exactly correct when superimposing it to define the active site of my homology model. It should be considered that the alignment will not be perfect and that the superimposing/aligning was only to define an active site of my homology model. It also isn't known if TCL is an inhibitor of the Wbm Fab I protein just because it is for another Fab I protein of another organism. On Thursday I began running the large CB diversity library of nearly 50,000 ligands on 6 processors, and I look forward to seeing if there were any extraordinarly great compounds that GOLD screened, because the CB 306 library didn't produce any super great compounds. Next week I will analyze the GOLD diversity set run and also start helping Urvashi on any of her cloning steps.
Figure 1:PyMol image of the best docked conformation (out of 10) of ligand 145 of the 306 ligands from the CB306 library that was screened in GOLD at an austoscale of 0.1 against the homology model created for my Wbm Fab I protein. This ligand received a fitness score of 79.53, which is fairly high for a GOLD score. A second run of the top 10% (31 best ligands from Run 1) will validate whether this ligand may be a good inhibitor or not.
Figure 2: PyMol image of triclosan (TCL) which is a known inhibitor for other Fab I proteins of different species. This ligand was used to define the active site of the homology model (although it came from superimposing the ligand onto the homology model from the T. thermophilus Fab I protein. This ligand received a low fitness score from a GOLD run of 56.89. This score may be expected to be much higher, but with a homology model, it is not certain that TCL is a good inhibitor of the Wbm version of the protein. Furthermore, the homology model isn't directly the exact Wbm Fab I protein, it's just a predicted model.
Figure 3: Top 31 ligands (top 10% of library) from the small library of 306 ligands from the CB306 sdf file after inital screening by GOLD at an autoscale of 0.1 for the homology model of my Wbm Fab I protein that was based on the template of Fab I for A. phagocytophilum. Top ranked compound came in with a score of 79.53, while it should be noted that the inhibitor triclosan (TCL) came in with a low score of 56.89 when docked by GOLD back into the active site of the homology model protein. It should also be noted that the TCL inhibitor should not technically be expected to receive a high score because it was a known inhibitor of a Fab I protein from T. thermophilus. The TCL from another homologous protein was only used to be superimposed onto the homology model protein in order to try to roughly define the active site of the homology model.
102812
This week was a week of extreme disappointment. I spent the first half of the week midiprepping the DH5a pellets that I grew up last week, which were previously transformed with the new GST plasmid vector. The concentrations turned out quite high for the pEG(kt) vector, but it turned out that this happened to be a yeast expression plasmid that I couldnt use for transformation into bacteria. For the second half of the week, I spend a good amount of time trying to purify my two seperate 2.0 g protein pellets that were both grown up in 500 mL of LB last week for 18 hours at room temperature. My hopes were that the bacterial ribosomes would translate my protein slower so that multimers could be avoided. After sonicating one pellet with a normal sonication buffer, and lysing the other pellet with the once determined "hopeful" pH 5.05 B-Per solution, I proceeded to purify after making sure the lysed solutions were at around a pH between 7.5-8.0. For the B-Per solution I used a column with old Ni-NTA resin in it, and for the sonicated solution, I used a fresh column with fresh Ni-NTA resin. After purifying and characterizing (gel will be shown on the next week's wikispaces), there was some hope that my Fab I protein made it through to the Elution 1 step because it seemed that for each the sonicated and B-per'd solutions, there was a nice distinct but faint band in the exact location of where my protein would be expected. But the issue was that the Elution 1 bands were showing up very weak/faint even though I allowed a nice two hours for it to stain, and even after I gave it overnight to de-stain. My hopes were that the bands were faint cause of the Imperial protein stain being too old, but this was found out to not be the case after nanodropping the Elution 1's from the B-Per and the sonicated solutions (See Figures 5 and 6). With a nanodrop concentration near zero at 280 nm, it was time to think about the GST vector. But sadly, the vector that I was working on as a side project to clone into was a yeast vector (as explained previously). So now my project is at a standstill, and I may have to work with Urvashi on her Wbm DXR project. So beginning next week I will ask her if she needs any help on her project, and I may still be looking into a bacterial GST vector with Dr. B.
Figure 1: Run 1 of first of two midiprepped pEG(kt) plasmid nanodroped (wavelength measured at 260 nm). Notice that the concentration is quite high for this vector compared to a concentration that was taken from a pNIC-BSA4 plasmid earlier in the summer.
Figure 2: Run 2 of first of two midiprepped pEG(kt) plasmid nanodroped (wavelength measured at 260 nm). Notice that the concentration is quite high for this vector compared to a concentration that was taken from a pNIC-BSA4 plasmid earlier in the summer.
Figure 3: Run 1 of second of two midiprepped pEG(kt) plasmid nanodroped (wavelength measured at 260 nm). Notice that the concentration is quite high for this vector compared to a concentration that was taken from a pNIC-BSA4 plasmid earlier in the summer.
Figure 4: Run 2 of second of two midiprepped pEG(kt) plasmid nanodroped (wavelength measured at 260 nm). Notice that the concentration is quite high for this vector compared to a concentration that was taken from a pNIC-BSA4 plasmid earlier in the summer.
Figure 5: Elution 1 of purified Wbm Fab I protein after expressing for 18 hours at 25 degrees Celsius. The BL21 cells that this protein was grown up in was lysed with a normal sonication buffer via sonication. Notice that the concentration of protein is extremely low, and FPLC is probably not worth the time.
Figure 6: Elution 1 of purified Wbm Fab I protein after expressing for 18 hours at 25 degrees Celsius. The BL21 cells that this protein was grown up in was lysed with a the B-Per buffer that was at pH of 5.05 that was made a couple of weeks ago. Notice that the protein concentration showed up as a negative value, thus signifying that pretty much there was not enough protein for even the expensive nanodrop spectrophotometer to even pick up on.
102112- Daniel, good deal. I am eager to see if the overnight expression worked! - Dr. B
101912
This week I went in two separate directions for my research project. My first direction was to express more of my Wbm Fab I protein on a large scale. By using two 2L flasks of 500 mL of LB each, I successfully grew up the two cell+protein pellets that are shown in Figure 2. The starter cultures that I made for the expression took an abnormal amount of time to grow and some didn't grow at all. I ended up using one of my starter cultures that I grew up overnight at room temperature in one of the shaking incubators in the Biotech Lab. The fact that some of these cultures didn't grow up properly means that I should probably transform some more of my cloned gene into BL21's for future expressions to go more smoothly. The starter culture that did grow up properly was then placed in the two giant flasks of LB until an OD600 of 0.1 was reached. I then grew up these large flasks at 37 degrees Celsius until an OD600 of 0.65 was reached (I want to see what a slight overexpression may do to my protein product). Then I turned the shaking incubator down to 25 degrees Celsius (room temperature), and then I induced the bacteria with IPTG. I proceeded to allow the bacteria to translate my protein for exactly 18 hours overnight, and then I spun down the cells that are shown in Figure 2. The only problem was that the growth was actually at 29 degrees Celsius according to the thermometer on the Biotech Lab shaking incubator, and the temperature wouldn't go any lower. The second direction in which I went in this week was to transform the pEG(KT) vector that was taken from the Robertus Lab last week into DH5a's. It was found that this plasmid carries the AMP resistance gene and not the Kan resistance gene. Some colonies on the AMP plate were then grown up overnight in a 37 degree shaking incubator and then spun down to retain the cell pellet that is shown in Figure 1. The next step is to midiprep this to extract large volumes of the plasmid DNA. Then based on purification next week, I will decide if I want to go ahead with trying to clone with this GST tag vector or continue with purification and expression of my His-tagged protein as is.
Figure 1: Image of DH5a cell+pEG(KT) replicated plasmid grown up in Ampicillin overnight at 37 degrees Celsius and spun down at 6000 x g on Allegra benchtop centrifuge for 15 minutes at 4 degrees Celsius. These pellets were placed in the -20 degree Celsius freezer for later midiprepping of the DNA.
Figure 2: Image of BL21 cell pellet + expressed Wbm Fab I protein after large scale expression that slightly overexpressed these cells to grow to an OD600 of about 0.65 at 37 degrees Celsius before inducing with IPTG and allowing to express protein overnight at room temperature on shaking incubator. The bacteria and protein were spun down with the JA-10 rotor in the large Beckman-Coulter centrifuge at 6000 x g for 20 minutes at 4 degrees Celsius. The resulting pellet was frozen in the -80 degree Celsius freezer for later purification and characterization steps.
101612 - Daniel - good deal. Also consider the overnight expression with IPTG at 25 degrees (instead of 37deg). -- Dr. B
- ALSO - I think you might be looking at the wrong ladder image - use this one and your protein seems like it is at the right size!:
http://www.thermoscientificbio.com/protein-electrophoresis/pageruler-prestained-protein-ladder/
101112
This week I lysed the BL21 cells that expressed my protein. I had three cell pellets that were expressed in 150 mL of LB last week. One of the pellets was lysed through normal sonication with a normal sonication buffer (4 mL) that had a higher ionic concentration (500mM NaCl). The second pellet was lysed with 4 mL of B-Per solution with a pH adjusted to 5.05. The third pellet was lysed with 4 mL of B-Per solution with a pH adjusted to 8.65. After purifying the clarified lysate soluble fractions of my three pellets through a Ni-NTA column, it was found that my protein was somewhat included in the soluble fraction of all three lysing conditions. The pH 5.05 B-Per buffer seemed to produce the best and most distinct band for the first elution. The pH 8.65 buffer didn't produce quite as distinct a elution 1 band. Although these bands showed up, they weren't very distinct at all. There were contaminate bands that showed up in the elutions that appeared more distinctly than my actual protein (these bands did not represent multimers of my protein). Now there are a few options of where to go from here on out. On one hand, there is some of my protein being expressed and making it through the Ni-NTA column in small amounts, but these amounts aren't huge. But the good news is that my protein has been found to be active in my enzyme assay that I performed a week ago. On the other hand, it takes so much time and effort to make such small amount of my protein although it is active. Now I have to make a decision if I want to continue to try to express under different conditions until the optimal condition is found, or I could go on and perform a large scale expression with this pH 5.05 B-Per buffer. The other option is to use another vector (pEG(KT)) that expresses a GST tag instead of a His tag. I should decide on what direction I want to turn to for next week's lab work.
Figure 1: Image of my SDS-page gel after testing separate lysing conditions for my WBM FABI protein. (Lane 1 on far right - Lane 8 on far left). My FABI protein was present in the soluble fraction and the first elution, but it was very faint, which indicates that a lot of the protein did not make it thru the Ni-NTA column. There also was a fairly distinct band that I circled that made it thru the Ni-NTA column. This band does not represent a dimer of my protein, and I do not know what this protein is.
Lane 1: Prestained pageruler protein ladder
Lane 2: Soluble fraction after sonicating with 500 mM NaCl, 100 mM Tris, 10 mM Imidazole buffer
Lane 3: Soluble fraction after lysing with B-Per solution that was pH balanced to a pH of 5.05
Lane 4: Elution 1 of the FABI protein that was lysed at pH 5.05 by B-Per
Lane 5: Elution 2 of Lane 4
Lane 6: Soluble fraction after lysing with B-Per solution that was pH balanced to a pH of 8.65
Lane 7: Elution 1 of the FABI protein that was lysed at pH 8.65 by B-Per
Lane 8: Elution 2 of Lane 7
Figure 2: Plasmid map of pEG(KT) vector. This vector might be used to clone my WBM FABI gene into because this vector expresses a GST tag instead of a His Tag. The His tag from the pNIC-BSA4 cloning that I have right now may be aggregating towards the center of my protein, thus not being able to stick to the Ni-NTA resin in the column.
101012
Figure 1: Nanodrop of WBM FABI protein at 280 nm from Elution 1 of purified (Ni+NTA column) protein. This was the first of the two Nanodrop concentrations from the same Elution 1 sample conical tube. This was the protein that was lysed from E. Coli BL21 competent cells with a B-Per buffer with a pH of 5.05
Figure 2: Nanodrop of WBM FABI protein at 280 nm from Elution 1 of purified (Ni+NTA column) protein. This was the second of the two Nanodrop concentrations from the same Elution 1 sample conical tube. This was the protein that was lysed from E. Coli BL21 competent cells with a B-Per buffer with a pH of 5.05
Figure 3: Nanodrop of WBM FABI protein at 280 nm from Elution 1 of purified (Ni+NTA column) protein. This was the first of the two Nanodrop concentrations from the same Elution 1 sample conical tube. This was the protein that was lysed from E. Coli BL21 competent cells with a B-Per buffer with a pH of 8.65
Figure 4: Nanodrop of WBM FABI protein at 280 nm from Elution 1 of purified (Ni+NTA column) protein. This was the second of the two Nanodrop concentrations from the same Elution 1 sample conical tube. This was the protein that was lysed from E. Coli BL21 competent cells with a B-Per buffer with a pH of 8.65
100912 - Daniel, ok good. hopefully the BPER with basic conditions works in a scale up expression along with new purification buffers and new ni-nta resin. - DR. B
We'll also pursue the GST tag
100512
This week I primarily focused on a pair of related things. First, I spent time making 2 10ml aliquots of B-Per lysis solution with different conditions associated with them both. The first B-Per solution involved setting the pH of the solution to 5, and the second solution involved setting the pH to 8.5. Hopefully these pH conditions will help solve the protein problem that I am having when trying to recover it from the soluble fraction after the lysis step. Additionally, I created a lysis buffer for sonication that is normal in all aspects except for the fact that I increased the salt concentration from 300 mM to 500mM in hopes that higher ionic conditions may reduce multimers that my protein are forming. In the second half of the week, I spent time expression my protein on a downscaled version compared to the upscaled expression that I have done in the summer. I grew up a starter culture, grew some bacteria up in 3 150mL flasks, and then induced the bacteria with IPTG so that they could express my protein. I successfully spun down 3 separate protein pellets that will all be used for lysing with the 3 different solutions that I made earlier in the week. I will perform this lysing step next week, and then I will run the protein SDS-page gel to see how my different lysing conditions fared. On a side note, I also transformed some more BL21 cells with my FABI+pNIC plasmid because when I made a starter culture, only one of the colonies I used worked in one flask, but the colony used in the other flask were apparently dead. So I figured it's always nice to have some fresh bacteria with my vector in it for future expressions.
Figure 1: 40 ng of FABI+pNIC-BSA4 plasmid transformed into 25 uL of E. Coli BL21 competent cells on Kan+Suc plates. Notice that the transformation went smoothly and was done because my plates from the summer are considered too old now.
Figure 2: 10 mL B-Per lysis solution at a pH of 5.05 and 8.63. Along with these solutions, a lysis buffer for sonication was also made with all conditions for a normal sonication buffer kept the same besides increasing the NaCl concentration up from 300mM to 500mM.
Figure 3: Three BL21 cell+ FABI protein pellets that were expressed and stored in the -80 degree Celsius freezer for lysis in the upcoming week by the different lysing solutions that were described in figure 2.
100112 - Daniel, ok - making progress (not sure if it is forward or backward progress!) but hopefully your modifications to the purification may lead to soluble protein. Let me know if SHACKLETON is still misbehaving (bad cat!) - and I can send it back to Ocean Optics/Vernier. -- Dr. B
092812
Figure 1: WBM FabI enzyme assay with snap frozen enzyme from summer protein expression. The blue line is a 400 uL solution of 392 uL Tris 7.5 pH buffer and 8 uL of NADH substrate. Notice the blue line compared to the blue line of last week's figure 1. There is a ten-fold reduction in the amount of absorbance that is being read by the spectrophotometer at 340 nm. The red line is a second run with another fresh tube of NADH (just like the blue line run). Notice that the absorbance is even less, but this shouldn't make sense since the NADH was only a few days old and frozen at the same time. The green line represents 384 uL of buffer, 8 uL of NADH substrate, and 8 uL of Crotonyl-CoA cofactor. The absorbance did decrease in the presence of the cofactor, but the trustworthiness of this is shaky, just as the rest of the data in this figure. (Read on the 'Shakelton' spectrophotometer).
Figure 2: WBM FabI enzyme assay with glycerol enzyme from summer protein expression. The red line represents a 400 uL solution of 392 uL Tris pH 7.5 buffer and 8 uL of NADH substrate. This 340 nm absorbance reading should be shown with a much higher reading for the NADH substrate instead of a 0.000 reading. This shows that the Shakelton RedTide spectrophotometer is not working properly.
Figure 3: WBM FabI enzyme assay with glycerol enzyme from summer protein expression. The red line represents a 400 uL solution of 392 uL Tris pH 7.5 buffer and 8 uL of NADH substrate.This 340 nm absorbance reading of around 0.62 is more respectable and reasonable than in Figure 2. The blue line shows the reaction when represents 384 uL of buffer, 8 uL of NADH substrate, and 8 uL of Crotonyl-CoA cofactor. The absorbance did decrease in the presence of the cofactor, but it should have gone to 0 as all of the NADH was eaten up by the enzyme in the presence of the cofactor. But when more diluted enzyme was added in small amounts the absorbamce actually decreased. This led to the green line in which the same initial conditions as the blue line were introduced, but after a minute, 200 uL of stock (glycerol) enzyme was placed into solution. The absorbance of NADH immediately decreased to 0, which was what should happen. Then after 3 minutes, 8 uL more of NADH was added and the absorbance spiked as it should. Then the last 2 dips in the green line are 50 uL of stock enzyme being added to solution. As can be seen, the introduction of more enzyme yet again decreases the absorbance of NADH. The orange line represents a continuation of the green line, but now from 5-10 minutes. The introduction of other various factors was added to the solution. More enzyme was added, and more Crotonyl-CoA cofactor was added when the sharp dips in the graph are shown. (Used spectrophotometer Henry).
This week was a much better week in terms of success. I ran another enzyme assay with some of my snap frozen protein. This was initially unsuccessful because the Shakelton spectrophotometer was used. This was proven when a fresh sample of NADH was taken and there was no absorbance being read at 340 nm. This problem was solved by using the Henry spectrophotometer instead. But Henry showed the same results as last week initially (back when Shakelton was working I guess). The results were that the reaction of the degradation of NADH by FabI in the presence of Crotonyl-CoA partially decreased the absorbance of NADH, but didn't fully take it to 0. This was solved by adding more stock enzyme with everything else still the same as before. What resulted was that the absorbance of NADH at 340 nm shot straight down to 0. This proved the functionality of my enzyme. The only problem was that there just was so little enzyme after FPLCing. By adding more, the functionality of my enzyme was confirmed.
092112 - Daniel, ok at least there is hope that they assay might work if you get a good protein sample. -- Dr. B
This week's work in the lab proved to be another setback in the overall process of searching for novel inhibitors for my WBM FABI protein project. I spent Tuesday afternoon working with Michael to make dilute enzyme, substrate, and cofactor in order to perform an enzyme assay. In this assay the purpose was to check whether my enzyme was functional or not. I measured the absorbance at 340 nm because that is the wavelength at which the substrate NADH gives off the best signal. In Figure 1 below, results were as expected. I expected that there would be a high but constant signal because all there was in the solution that was being measured was NADH and the FABI enzyme. Figure 2 also yielded expected results because all there was in the solution was my enzyme and Crotonyl-CoA, which is a cofactor that helps catalyze the reaction of the FABI enzyme. With no NADH present in solution, there shouldn't be any signal at 340 nm. Figure 3 is where things went down the drain. With both the cofactor and NADH in the solution along with my reductase enzyme, the enzyme should have began eating up NADH in the presence of the cofactor. So what should have been expected was that the absorbance slowly tapered off to a reading of zero as the enzyme degraded all of the NADH, thus there being no more NADH to give signal at 340 nm. Figure 4 was placed in the same conditions as Figure 3, except with double the amount of NADH and cofactor involved. What I found interesting is that the NADH signal was reduced by more than half when in the presence of the Crotonyl-CoA. This must mean that the enzyme was somewhat functioning in reacting with the NADH in the active site, but it wasn't completing the degradation of NADH at a very fast rate because it can be seen that the orange line representing the absorbance reading of NADH in Figure 3 never really decreased. There are two possibilities that are going through my mind at this point. Either the FABI enzyme really isn't functioning properly, or the enzyme just didn't exist in the first place. What I mean by that is that I have been having trouble with my protein expression, and after FPLC, there is practically no protein left to be collected. If the protein formed multimers, it wouldn't be functional. There is no telling if I actually collected a sufficient amount of protein, or if it was even the correct protein after FPLC. This is why I need to figure out a way to get my protein to stay in the soluble fraction after spinning down. Next week I am going to do some research into journal articles to try to see if I can do anything to get my protein to solubilize. I have a feeling that my protein isn't very friendly with common pH values, so I may just take a shot in the dark and try expression and other things at different pH's in the future.
Figure 1: Blank with 100 uL of protein stock of 200 ng/uL, 292 uL of 100mM Tris at pH 7.5, and 8 uL of 5mM NADH substrate working solution. Notice that a absorbance is measured at 340 nm, which is the wavelength at which NADH emits signal. A high straight line absorbance (blue line) should be expected in this situation because NADH is present in a constant amount.
Figure 2: Blank with 100 uL of protein stock of 200 ng/uL, 292 uL of 100mM Tris at pH 7.5, and 8 uL of 12.0 mM Crotonyl-CoA cofactor working solution. Notice that the green line at the bottom with an absorbance of 0 at 340 nm. This should also be expected because Crotonyl-CoA gives off no signal at this wavelength, and since there is no NADH present, there should also be no signal.
Figure 3: Positive control 1 with 100 uL of protein stock of 200 ng/uL, 284 uL of 100mM Tris at pH 7.5, 8 uL of 5 mM NADH working solution substrate, and 8 uL of 12.0 mM Crotonyl-CoA cofactor working solution. Since there is NADH in the solution, there should be signal at 340 nm (orange line), but the signal should go down to zero because the cofactor Crotonyl-CoA is present. When both the substrate and cofactor is present, the substrate gets eaten up by the reaction that is catalyzed by FABI in the presence of Crotonyl-CoA.
Figure 4: Positive control 2 with 100 uL of protein stock of 200 ng/uL, 268 uL of 100mM Tris at pH 7.5, 16 uL of 5 mM NADH working solution substrate, and 16 uL of 12.0 mM Crotonyl-CoA cofactor working solution. Since there is NADH in the solution, there should be signal at 340 nm (purple line), but the signal should go down to zero because the cofactor Crotonyl-CoA is present. When both the substrate and cofactor is present, the substrate gets eaten up by the reaction that is catalyzed by FABI in the presence of Crotonyl-CoA. Since more NADH was added, there was a higher signal than in Figure 3, and since the enzyme was not functional with Crotonyl-CoA added, the absorbance stayed the same.
091212
Lane 1: Pageruler prestained protein ladder
Lane 2: Sample 1 of Flask A (normal amount 500mM of IPTG added) after induction
Lane 3: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer. Grown in 500mM IPTG
Lane 4: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer & 2mM TCEP. Grown in 500mM IPTG
Lane 5: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer & 10mM TCEP. Grown in 500mM IPTG
Lane 6: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer. Grown in 250mM IPTG
Lane 7: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer & 2mM TCEP. Grown in 250mM IPTG
Lane 8: Soluable fraction, after sonicating in NORMAL 300mM NaCl, 100mM Tris, 10mM Imidazole buffer & 10mM TCEP. Grown in 250mM IPTG
Lane 9: Soluable fraction, after lysing in B-Per buffer. Grown in 500mM IPTG
Based on these results, it can be seen that despite efforts to reduce multimers, my FABI protein is still mainly being lost in the soluble fraction step. It still seems as if the protein isn't being released from the cell properly after the cell is lysed through the sonication process. It seemed as if the B-Per lysing solution worked better than sonication did. The B-Per lane of the gel showed at least a considerable amount more of a protein band than the sonicated lanes of the gel. This makes me believe that although multimers may still be a problem, there might be a larger problem than just the multimers. It seems to me that perhaps the lysing of the bacterial cells that were induced to create my protein could be the core to the problem of losing most of my protein after spinning down and collecting the soluble fraction. Another consideration may be that my protein is just somehow insoluble in an aqueous solution that predominately contains water. My next step from here is to continue and perform an enzyme assay to test for the activity of the small amount of FABI protein that made it into the soluble fraction on my previous expression attempts over the summer. At the same time, I will be looking at papers and journal articles that have anything to do with the expression of a FABI enzyme in another organism, or another similar reductase.
090712 - This week I prepared for a small scale protein expression that I will perform next Monday. I made two SDS-page gels, autoclaved LB and allocated to LB appropriately to separate Erlenmeyer Flasks. I also transformed BL21's with the pNIC-BSA4 plasmid with my gene cloned within the plasmid. I also created three different lysis buffers that contain different amounts of TCEP. I created a B-per lysis solution as well, which will replace sonication as the primary form of lysing the bacteria. I am doing this in order to try to find conditions in which my protein will not be stuck at the bottom cell pellet when centrifuging after sonication and retaining the soluble fraction.
070212 - Daniel - great results. I am going to be so excited on the day when you 'flip' your page to reverse chronological order. I can't wait....we'll have fireworks and champagne! -- Dr. B
062112 - Dnaiel. Glad you got the pGFP pcr to work. Your results and postings look great. You can put them in reverse chronological order - just separate by a line break or a date entry. -- Thanks, Dr. B
7/25/12
Measure 1 of the OD of my FABI gene after purification. Absorbance looks decent, which will yield about 4.5 mg of protein. But there is no telling how much of my actual WBM FABI protein will be present after FPLC. Measure 2 is shown below.
7/17/12
Hypothesized sequence of FABI inserted into pNIC-BSA4 Vector
TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTT
TGTTTAACTTTAAGAAGGAGATATACATATGCACCATCATCATCATCATTCTTCTGGTGT
AGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGGCGATTTCTCTGCTGCAGGGCAA
AAAAGGTCTGATCACCGGCATTATCAACAAACGTTCTATCGCGTACGGTATCGTTAAAAC
CCTGAGCGAACATGGTGCAGAATCTGCGGTTACCTACCAGAACGAAATCGTCAAAGAACG
TCTGCTGAGCATTGCCGCGGAACTGAACGTTGAACTGGTTCTGAACTGCGACGTTGCGAA
CGAAGGTACCATCGACGACGTTTTCAAATCTATCGAAGAAAAATGGGGTACGCTCGACTT
TCTGGTTCACGCAATCGCATTCTCTGACAAAAACGAACTGTCTGGTAAATACGTTAACAC
CTCTCTGAACAATTTCCAAAACGCCATGAACATCTCTTGCTACTCTTTCACTGCGCTGGC
GCAACGCGCTGAAAAGATGATGCCAAATGGTGGTTCTCTCCTGACGCTGTCTTACTACGG
TGCGGAAAAAGTTATGCCGAACTACAATGTTATGGGTCTGTGCAAAGCGGCTCTGGAAGC
GTCTGTTAAATACCTGGCGTGCGACCTGGGTCCGCAGAACATCCGTGTAAACGCGATCTC
TGCGGGTCCGATCCGTACCCTGGCGAGCTCTGGTATTTCTGACTTCCACTTCATCAGCGA
ATGGAACCGTAACAACTCTCCGCTGCGTCGTAACACCACCCTGGAAGACGTTGGTAAAGC
CGCCCTGTACCTGCTGTCTGACCTGTCCTCTGGCACGACGGGTGAGATCCTGCACGTTGA
CTCTGGTTACAACGTAGTTGGTATGAAAGCGATCGATTCTAACATCATTAATTCTTACCA
AAATTGACAGTAAAGGTGGATACGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCC
GCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAA
GCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAA
CGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAATGGGACG
CGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTA
CACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGT
TCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTG
CTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCAT
CGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGAC
TCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAG
GGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACG
CGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGC
GCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAATT
AATTCTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTA
TCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAG
TTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATA
CAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTG
ACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACA
GGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGT
GATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGA
ATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCA
GGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCAT
GCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGC
CAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTC
AGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGC
CCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAAT
CGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTG
TTTATGTAAGCAGACAGTTTTATTGTTCATGACCAAAATCCCTTAACGTGAGTTTTCGTT
CCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCT
GCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCC
GGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACC
AAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACC
GCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTC
GTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTG
AACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATA
CCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTA
TCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGC
CTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTG
ATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTT
CCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGT
GGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGA
GCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTAC
GCATCTGTGCGGTATTTCACACCGCATATATGGTGCACTCTCAGTACAATCTGCTCTGAT
GCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGC
CCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCG
CTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCAT
CACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCAC
AGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCT
GGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGCCT
CCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGC
TCACGATACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAAC
AACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAGCGCT
TCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCC
GGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAAC
CGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACG
TTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCC
GGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGGGCCGCCATGCCGGCGATAA
TGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGG
CGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGC
GGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAA
AGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCACCGGAAGGAGCTGA
CTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAAC
TTACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGC
TGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTG
GTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGA
GAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATG
GTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAG
ATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATC
TGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTT
TGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGA
TTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAAT
GGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGT
CGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGACATCA
AGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCC
AGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCT
TTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGA
TCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAG
GTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGA
ATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGG
CTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACA
TCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTAT
CATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCC
CTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGC
CGCCGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCC
TGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTC
CCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCC
GGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTCGATCCCGCGAAAT
7/17/12
DNA sequencing Sample 6 Forward
NNNNNNNNNNNNNNNCTTTAGANGAGATATACATATGCACCATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGGCGATTTCTCTGCTGCAGGGCAAAAAAGGTCTGATCACCGGCATTATCAAAAACGTTCTATCGCGTACGGTATCGTTAAAACCCTGAGCGAACATGGTGCAGAATCTGCGGTTACCTACCAGAACGAAATCGTCAAAGAACGTCTGCTGAGCATTGCCGCGGAACTGAACGTTGAACTGGTTCTGAACTGCGACGTTGCGAACGAAGGTACCATCGACGACGTTTTCAAATCTATCGAAGAAAAATGGGGTACGCTCGACTTTCTGGTTCACGCAATCGCATTCTCTGACAAAAACGAACTGTCTGGTAAATACGTTAACACCTCTCTGAACAATTTCCAAAACGCCATGAACATCTCTTGCTACTCTTTCACTGCGCTGGCGCAACGCGCTGAAAAGATGATGCCAAATGGTGGTTCTCTCCTGACGCTGTCTTACTACGGTGCGGAAAAAGTTATGCCGAACTACAATGTTATGGGTCTGTGCAAAGCGGCTCTGGAAGCGTCTGTTAAATACCTGGCGTGCGACCTGGGTCCGCAGAACATCCGTGTAAACGCGATCTCTGCGGGTCCGATCCGTACCCTGGCGAGCTCTGGTATTTCTGACTTCCACTTCATCAGCGAATGGAACCGTAACAACTCTCCGCTGCGTCGTAACACCACCCTGGAAGACGTTGGTAAAGCCGCCCTGTACCTGCTGTCTGACCTGTCCTCTGGCACGACGGGTGAGATCCTGCACGTTGACTCTGGTTACAACGTAGTTGGTATGAAAGCGATCGATTCTAACATCATTAATTCTTACCAAAATTGACAGTAAAGGNGGATANGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCANCACCACCACCACCACTGAGATCCNGCTGCTAACNAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCNCGCTGANCATANTAGCATNACCCCNNGGNNNCTAAANGGNNTTGANGGNTTTTGCTGAAAGNGANTATNTCNNTGNNANGGGNNNNNNCCNGNNNNGNNNNTNNNNNNNNNGNNNNNNNCNNNANNNNNCNNNNNNNNNAGNNNCNNNNNNNNNNN
NNNNNNTTNNNNCGNNNNTNCNNNNNNNNNNNNANNNNNNN
*Notice that the entire FABI gene is included in this sequencing forward read, without any deletions or insertions
7/11/12
Figure 1: Image of Sample 1 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 2: Image of Sample 2 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 3: Image of Sample 3 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 4: Image of Sample 4 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 5: Image of Sample 5 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 6: Image of Sample 6 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 7: Image of Sample 7 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
Figure 8: Image of Sample 8 of Nanodrop of my FabI gene inserted into the pNIC-BSA4 accepting vector
PNIC Accepting vector RE DIGEST
Lane 1: Skip
Lane 2: 100 bp DNA ladder, but there should have been a 1 kb ladder
Lane 3: Michael RE digest of pNIC-BSA4 accepting vector (from top to bottom, multimer band, uncut plasmid, two cuts of the pnic plasmid)
Lane 4: Daniel RE digest of pNIC-BSA4 accepting vector (from top to bottom, multimer band, uncut plasmid, two cuts of the pnic plasmid)
Lane 5: Andrew RE digest of pNIC-BSA4 accepting vector (from top to bottom, multimer band, uncut plasmid, two cuts of the pnic plasmid)
Measure of pNIC-BSA4 accepting vector take two
070212
Measure 1 of pNIC-BSA4 accepting vector
Measure 2 of pNIC-BSA4 accepting vector
As it can be seen, the prepared pNIC accepting vector that was cleaned up via PCR cleanup didn't yield a high concentration of pNIC gene, but it can still perhaps be used. Instead of risking transformation with this low concentration of pNIC, I went ahead and re-did my pNIC preparation and yielded about twice the concentration of pNIC plasmid DNA as shown below. This was the DNA that I used for annealing and transformation.
062712
Lane 1: Skip
Lane 2: 100 bp DNA ladder
Lane 3: Daniel PCR squared
Lane 4: Daniel PCR squared
Lane 5: Daniel PCR squared
Lane 6: Daniel PCR squared
Note: This second try at my PCR squared worked. Much more amplification of DNA and much less contamination. The high amplification of DNA shown below by nanodrop results.
Measure 1
Measure 2
Lane 1: Skip
Lane 2: 100 bp DNA ladder
Lane 3: Daniel PCR squared
Lane 4: Daniel PCR squared
Lane 5: Daniel PCR squared
Lane 6: Daniel PCR squared
Lane 7: Michael PCR squared
Lane 8: Michael PCR squared
Lane 9: Michael PCR squared
Lane 10: Michael PCR squared
My PCR squared didn't work as well as I would like to. There was contamination (shown as the bottom bands in the lanes), and there was not much amplified WBM FabI DNA. This is confirmed through the PCR cleanup of these samples in Lanes 2-6, where the nanodrop results yielded a low concentration.
Measure 1
Measure 2
Lane 1: Skip
Lane 2: 100 bp DNA ladder
Lane 3: Daniel secondary PCR overlap (with my own diluted 20 uM forward and reverse primers) (10x ThermoPol buffer, 25mM MgSO4. 2mM dNTPs, 1uM Oligo Mix from primary PCR, KOD polymerase, Autoclaved water, 20um Forward and Reverse Primers)
Lane 4: Skip
Lane 5: Skip
Lane 6: Rishi Secondary PCR overlap
Lane 1: Skip
Lane 2: 100 bp DNA ladder
Lane 3: Michael Primary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, Autoclaved Water)
Lane 4: Michael Secondary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, 20 uM Forward and 20 uM Reverse Primers, Autoclaved Water)
Lane 5: Max Primary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, Autoclaved Water)
Lane 6: Max Secondary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, 20 uM Forward and 20 uM Reverse Primers, Autoclaved Water)
Lane 7: Daniel Primary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, Autoclaved Water)
Lane 8: Daniel Secondary PCR (10x ThermoPol buffer, 25mM MgSO4, 2mM dNTPs, 1 uM Oligo Mix, KOD Polymerase, 20 uM Forward and 20 uM Reverse Primers, Autoclaved Water)
062112
Lane 1: Skip
Lane 2: 100 bp DNA ladder
Lane 3: 0.0824 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Daniel
Lane 4: 0.824 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Daniel
Lane 5: 8.24 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Daniel
Lane 6: 0 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Daniel
Lane 7: 0.0824 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Michael
Lane 8: 0.824 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Michael
Lane 9: 8.24 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Michael
Lane 10: 0 ng of pNic-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLic (forward) and pLic (reverse) primers) – Michael
Note: This pNIC-BSA4 pcr worked because this time the pLIC primers were diluted to a proper 2.5 uM working solution.
Note: This pcr failed because it required a working solution of forward and reverse pLIC primers of 2.5 uM, but we accidentally used the stock solution of the primers of 100 uM.
Lane 1: 100 bp ladder
Lane 2: 0.00824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) -Daniel
Lane 3: 0.0824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) - Daniel
Lane 4: 0.824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) – Daniel
Lane 5: 0 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) – Daniel
Lane 6: 0.00824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) - Kaarthik
Lane 7: 0.0824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) - Kaarthik
Lane 8: 0.824 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) – Kaarthik
Lane 9: 0 ng of pNIC-BSA4 in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, pLIC (forward) and pLIC (reverse) primers) – Kaarthik
PCR - pGFP
Lane 1: Skip
Lane 2: 5 ul 100 bp ladder
Lane 3: 0.016 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, VDS 1 (forward) and VDS 2 (reverse) primers)
Lane 4: 0.16 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, VDS 1 (forward) and VDS 2 (reverse) primers)
Lane 5: 1.6 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, VDS 1 (forward) and VDS 2 (reverse) primers)
Lane 6: 0 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, VDS 1 (forward) and VDS 2 (reverse) primers)
Lane 7: 0.016 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, M13 (forward) and M13 (reverse) primers)
Lane 8: 0.16 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, M13 (forward) and M13 (reverse) primers)
Lane 9: 1.6 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, M13 (forward) and M13 (reverse) primers)
Lane 10: 0 ng total pGFP plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP’s, Taq polymerase, M13 (forward) and M13 (reverse) primers)
*As it can be seen, the VDS primers produced bands that were much higher up and much more distinct on the gel than the M13 Primers. It was good to see that lanes 6 and 10 both had the faintest bands because there was no DNA template added to these wells, but there may have been residue DNA from the other wells that may have found its way into lanes 6 and 10, which produced the barely visible bands. As was expected, the bands sort of gained intensity with the amount of pGFP plasmid that was introduced to each sample well, but I would have liked to see more of an intensity gradient in the bands. It is still interesting how the bands for the M13 primers were much lower on the gel than with the VDS primers. Dr. B told me that all the bands should be in about an uniform position on the gel, so I should follow up on why the lack of uniformity occurred.
062112 - PCRs look good - you could crop these images a little more aggressively so that the detail could be seen better -- Thanks, Dr. B
PCR-pGBR22
Lane 1: Skip
Lane 2: 100bp DNA ladder
Lane 3: 1 ul of 0.3 ng total pGBR22 plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP's, Taq, M13 Forward and Reverse Primers)
Lane 4: 10 ul of 3.0 ng total pGBR22 plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP's, Taq, M13 Forward and Reverse Primers)
Lane 5: 10 ul of 3.0 ng total pGBR22 plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP's, Taq, M13 Forward and Reverse Primers)
Lane 6: 0 ul of 0.0 ng total pGBR22 plasmid in 25 ul total test tube (water, ThermoPol buffer, dNTP's, Taq, M13 Forward and Reverse Primers)
Transformation of pGFP
Figure 1: After incubation of DH5alpha with 1 ng of pGFP (1.58 lambda) plasmid transformed into the E. Coli bacterial cells.
Figure 2: After incubation of DH5alpha with 5 ng of pGFP (1.58 lambda) plasmid transformed into the E. Coli bacterial cells.
Figure 3: After incubation of DH5alpha with 25 ng of pGFP (1.58 lambda) plasmid transformed into the E. Coli bacterial cells.
Note: As it can be seen, there was not a significant difference in the amount of bacterial DH5alpha bacterial colonies that showed up on the plates. It was expected that as the amount of the pGFP plasmid (in nanograms) was transformed into the bacteria, the more colonies would appear. This theory was proven to be false because of the amount of total tube contents that was plated. Because not a small amount of tubular content was plated, a huge amount of bacteria grew in the plates overnight, thus proving quite hard to count the total number of bacterial colonies to test for a significant increase in transformation efficiency.
https://docs.google.com/file/d/0B4O2KqKh2q_-eFNGQUhuc05kRDA/edit - Link to Primer Design for CDS coding sequence for PNIC-BSA4 expression vector with my FabI
RE Digest Results:
From left to right, 1KB ladder, EcoRI, PvuII, EcoRI+PvuII bands expected based on Analyzing DNA sequencing lab.
As it can be seen, the bands from my gel showed up mostly as expected. A band at about 3kb appeared in lane 3 (uncut plasmid), which was about the same position as the single band in the EcoRI lane 4. This should be expected because the EcoRI cut the circular uncut pGBR22 plasmid into a linear gene, but there is still one gene fragment that should be of equal size as the uncut plasmid. Lane 5 should show 2 distinct bands in the gel according to the theoretical image above. After experimenting, two bands did show up in about the same position as hypothesized when the PvuII was added. When both PvuII and EcoRI was added (lane 6), three bands should be shown to distinguish 3 cuts in the plasmid which create 3 fragments of the DNA. In my experimental gel, two and a half bands showed up in the correctly hypothesized spots. The one band that did not completely show up in my gel could be because the gel electrophoresis was not allowed long enough to run, or it could have been because of my pipetting skills when adding the liquid to the well of lane 6.
061212 - Daniel, I think that 'missing' band is really there - it is just too weak to distinguish on the gel. But you can see a shift in the band above indicating that there was another piece cut. --DR. B
DNA Sequencing Results:
NNNNNNNNNNNNNGGGCGANTGGGCCNGACGTCGCATGCTCCCGGCCGCCATGGCCGCGGGATTTTAGTGATGGTGATGGTGATGACCGAGCAAAGAGTGGCGTGCAATGGATATTTCACACTGCTCAACAAATGTGTAATCCTTGTTGTGACTGGTTAC
ATCCAGTTTGCGGTCAACATAGTGATACCCTGGCATCCTCACAGGCTTCTTTGCCTTGTAAGTAGATTTGAATTCACACA
AATAGTAACCACCTCCTTCCAACTTCAGAGCCATAAAGTTGTTTCCTATCAGCATTCCATCTCGTGCAAAGAGACGCTCA
GTGTTGGGTTCCCAGCCCTGTGTCTTCTTCTGCATAACAGGTCCATTGGGAGGAAAGTTCACACCAGAGATTTTGACATT
GTAGATGAAACAGTTGCCTTGGATGCTGGAATCATTGCTGACAGTACACACTGCACCATCTTCAAAGTTCATGATCCTCT
CCCATGTATATCCCTCAGGGAATGACTGCTTTACATAATCAGGGATGTCTTCAGGGTACTTGGTGAATGGTATGCTTCCG
TATTGAGACAGTGGTGATAAAATATCCCAAGCAAATGGCAGAGGTCCACCCTTGGTGACAGTGAGCTTTACCGTCTGCTC
CCCCTCGTAAGGCTTTCCTTTTCCATCGCCTTCGACCTCAAAGTAGTGTCCATTGACCGTGCCTGACATATAAACCTTGT
AGGTCATTTGTTTAGCGATCACACTCATGATATTTCTCCTTCAATCAATCAAAATCACTAGTGCGGCCGCCTGCAGGTCG
ACCATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCA
TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAA
AGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCNCTCACTGCCCNCTTTCCAGTCGGNAANNCTGT
CGNGNCAGCTGCATNNNNANCNGCNACGNNNNGGGGGANNNNNNGNTNGCGNNTNGNNNCTCNTCNNTNCNTCNNNCANT
GACTNGNNNNNNNTNGNNNNNGNNNNNGNNNNNNNNNTCNNNTNNNNNNNGNNNGTNNTNCGNNNTNCNNNANNNNGNNN
NNNNNNNNNNNANNNNNNNNNANNNNNNNNGNCNNNANNCNNNAANGCNNNNNNNNNNNNGNNNNTTTNNNNNNNNN
*Forward DNA sequencing results of pGBR22 plasmid through use of the M13For-20 primer
NNNNNNNNNNGANNATAGANTACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGC
CGCACTAGTGATTTTGATTGATTGAAGGAGAAATATCATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGT
CAGGCACGGTCAATGGACACTACTTTGAGGTCGAAGGCGATGGAAAAGGAAAGCCTTACGAGGGGGAGCAGACGGTAAAG
CTCACTGTCACCAAGGGTGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACTGTCTCAATACGGAAGCATACCATT
CACCAAGTACCCTGAAGACATCCCTGATTATGTAAAGCAGTCATTCCCTGAGGGATATACATGGGAGAGGATCATGAACT
TTGAAGATGGTGCAGTGTGTACTGTCAGCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACAATGTCAAAATCTCT
GGTGTGAACTTTCCTCCCAATGGACCTGTTATGCAGAAGAAGACACAGGGCTGGGAACCCAACACTGAGCGTCTCTTTGC
ACGAGATGGAATGCTGATAGGAAACAACTTTATGGCTCTGAAGTTGGAAGGAGGTGGTTACTATTTGTGTGAATTCAAAT
CTACTTACAAGGCAAAGAAGCCTGTGAGGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAGTCACAAC
AAGGATTACACATTTGTTGAGCAGTGTGAAATATCCATTGCACGCCACTCTTTGCTCGGTCATCACCATCACCATCACTA
AAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTG
GCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGC
CAGCTGGCGTANTAGCNANANGCCCGCACCGATCGCCCTTCCCANCAGTTGCNCANNNNANGGNNATGGACNNNCCTGNA
GNGNGCATNNCNCGGNNGNNGTGGNNGNNCNNNCAGCGNGANNCTACNNNNCAGCNNNNNCNNNNNCNTNNGNNNNNNTN
NTNNNNGCNNNTNNCNNNNNTNANNNNNNNGGGNNNNNNNNNNCNANTTANNNNTNNNNNNCNNNCNNNNNNNNNNNGGN
NNNNNNNNNNNGNNNNNNNNNNCCNNNNNANNNNG
*Reverse DNA sequencing results of pGBR22 plasmid through use of the M13Rev-20 primer
https://docs.google.com/open?id=0B4O2KqKh2q_-RGlfc3YyVnJ6ZFU
Figure 1:Measurement 2 of pGFP bacterial DNA for absorbance at 230 nm. Concentration of plasmid is shown in bottom right green box at 935.4 ng/uL. Actual concentration of plasmid was 1580 ng/uL.
Figure 2:Measurement 1 of pGFP bacterial DNA for absorbance at 230 nm. Concentration of plasmid is shown in bottom right green box at 1012.4 ng/uL.
Actual concentration of plasmid was 1580 ng/uL.